22Июл

Палочки в мазке на флору у женщин: «Мазок на флору»: о чём расскажет анализ?

Содержание

Исследование мазка

Самым распространенным является мазок на флору или общий мазок, при помощи которого врач определяет так называемую чистоту влагалища у женщины. Что он показывает? Этим способом можно определить состояние клеток эпителия и выявить наличие заболеваний, вызванных патогенными микроорганизмами, таких как вагинит, кандидоз (молочница), вагиноз, цервицит.

В результате проведения бактериоскопического исследования также диагностируются некоторые заболевания, передающиеся половым путем — гонорея, трихомониаз. В основе анализа лежит способность разных микроорганизмов окрашиваться в разные цвета в зависимости от степени устойчивости к воздействию антибиотиков. Эта способность была открыта датским ученым Г. К. Грамом. В результате окрашивания биоматериала выявляются грамположительные (грам+) микроорганизмы, имеющие большую чувствительность к антибиотикам, и грамотрицательные (грам—), отличающиеся более тонкой и сложной в строении оболочкой и низкой чувствительностью к препаратам. Грамотрицательные микроорганизмы способны вызвать различные заболевания женской половой сферы.

Врач-лаборант в процессе проведения анализа под микроскопом подсчитывает количество по-разному окрашенных микроорганизмов, лейкоцитов, определяет форму бактерий, их размеры и расположение. В некоторых случаях исследуются неокрашенные (нативные) мазки, что позволяет обнаружить жгутиковые формы трихомонад. Кроме того, в рамках мазка на флору может проводиться так называемый посев на микрофлору. Он используется в тех случаях, когда возбудитель заболевания из-за его малой концентрации не может быть обнаружен под микроскопом и для определения рода и вида бактерий. В этом случае биоматериал, взятый из половых органов женщины, помещают в специальную питательную среду на основе желатина, и через определенное время изучают результат.

На заметку

Длительность культивирования посева зависит от того, присутствие какого микроорганизма необходимо выявить. Дольше всего созревает посев при хламидиозе — 15 дней.


Появление на питательном субстрате колоний микроорганизмов говорит о наличии заболевания. Метод посева также используется для определения стратегии лечения, поскольку во время созревания колонии можно выяснить, к воздействию каких групп антибиотиков она особенно неустойчива.

Мазок на скрытые инфекции. К скрытым инфекциям относят группу болезней, которые могут бессимптомно протекать на протяжении нескольких месяцев или даже лет, вызывая осложнения, а некоторых случаях — даже бесплодие. На сегодняшний день наиболее достоверным способом выявления скрытых инфекций является исследование мазка при помощи ПЦР (полимеразной цепной реакции). Этот метод используется для диагностики инфекций, не обнаруживаемых в общих мазках. Для проведения анализа берется секрет из шейки матки, влагалища или мочеиспускательного канала и производится многоэтапное повышение концентрации нуклеиновой кислоты и копирование отдельных фрагментов ДНК присутствующих в мазке микроорганизмов. В результате врач может установить видовую и родовую принадлежность всех патогенных бактерий и их способность вызывать развитие заболеваний.

В большинстве случаев ПЦР-анализ применятся при подозрении на наличие заболеваний, передающихся половым путем и имеющих на ранних стадиях практически бессимптомное течение.

Преимуществами метода являются:

  • высокая точность определения возбудителя инфекции;
  • возможность определения именно наличия вируса, а не продуктов его жизнедеятельности или распада;
  • возможность постановки точного диагноза на основе всего одной клетки микроорганизма.

Важно!

Метод ПЦР не выдает ложноположительных результатов, иными словами, положительных проб там, где отсутствует инфекция, не бывает.

Мазок на онкоцитологию, или тест по Папаниколау (пап-тест), позволяет выявить наличие онкологических заболеваний в шейке матки на ранних стадиях и вовремя начать терапию. Пап-тест определяет большинство воспалительных заболеваний, дисплазию эпителия и злокачественные образования. Сдавать этот мазок рекомендуется ежегодно всем женщинам в возрасте от 21 до 65 лет. В случае если у женщины наблюдаются нарушения менструального цикла, воспалительные процессы цервикального канала, бесплодие, врач назначит мазок на онкоцитологию в обязательном порядке. Также рекомендуется пройти пап-тест при диагностировании диабета, ожирения 2−3 степени, в период планирования беременности, при приеме гормоносодержщих препаратов и наличии в организме вирусов генитального герпеса и папилломы.

При анализе мазка можно получить пять типов результата в зависимости от наличия и степени патологии. Первый тип — это отрицательный показатель, говорящий о том, что никаких отклонений от нормы в организме женщины нет, и она полностью здорова. При втором типе присутствует воспалительное заболевание, требующее лечения. Третий тип свидетельствует о наличии в эпителии единичных клеток с аномальным строением ядра. Четвертый тип — подозрение на злокачественное образование или эрозию шейки матки, генитальный герпес, папиллломовирусную инфекцию, паракератоз. Пятый тип — наличие онкологического заболевания, требующего незамедлительного лечения. Следует помнить, что мазок показывает только степень изменения клеток, но не причину, их вызвавшую. Для постановки диагноза необходимы результаты других анализов, включая биопсию, кольпоскопию и гистологическое исследование.

Важно!

Если в мазке будут найдены атипичные клетки, то в заключении будет об этом написано, а также будет указан тип изменений. Если в расшифровке мазка на цитологию нет особых примечаний, это говорит о том, что в ходе исследования никаких патологий обнаружено не было.

Анализ мазка на флору у женщин и мужчин, спешите сдать по выгодным ценам в Москве.

Что такое ВАКЦИНАЦИЯ

В этой статье мне хотелось бы ответить на наиболее часто задаваемые вопросы по поводу проведения или не проведения профилактической вакцинации детей.

Нервная система младенца

Патология раннего детского возраста и особенно новорожденных представляет повышенную сложность для диагностического процесса. В большей степени это относится к неврологическому обследованию.

Обзор детских инфекций

Каждого взрослого при заполнении медицинской карты спрашивают: «Какими детскими инфекциями болели?»

Врожденный вывих бедра

Период новорожденности — один из важнейших периодов жизни человека, в течении которого происходит адаптация организма ребенка к условиям внеутробной жизни.

Что делать, если холестерин высокий?

Традиционно повышенный уровень холестерина считается одной из основных, но недоказанных причин образования атеросклеротических бляшек в кровеносных сосудах.

Эндометриоз

Основная группа риска — женщины в возрасте 25-44 лет. По статистике эндометриозом поражены 10-15% процентов дам детородного периода. Реже симптомы эндометриоза наблюдаются у мужчин и девушек младше 20 лет.

Если у ребенка болит живот

Чаще всего болевой синдром сопровождается диспепсическими расстройствами (тошнотой, отрыжкой, неустойчивым стулом, запорами). Важным симптомом является увеличение печени связанное с застоем желчи.

Гиперменорея

В клиниках IMMA в рамках оказания гинекологических услуг практикуют диагностические и лечебные мероприятия по борьбе с гиперменореей. Если возникла проблема чрезмерных выделений в дни месячных, продолжающихся более недели, мы поможем ее решить.

Атеросклероз

 Что же способствует формированию атеросклероза? В настоящее время обстоятельства и особенности образа жизни человека, которые ведут к этому называют «факторами риска».

Заболевания мошонки

Острое течение характеризуется внезапным появлением боли, сопровождающейся высокой температурой, ознобом, септическим состоянием.

Детская стоматология

Желательно чтобы первое посещение ребенком кабинета стоматолога было не по поводу лечения зубов, а просто для профилактического осмотра.

Мастит

Сеть медицинских клиник IMMA оказывает услуги по лечению и диагностике распространенного женского заболевания – мастит молочной железы.

Логопед

Речевые нарушения самостоятельно не исчезают, поэтому требуют коррекционной работы со стороны логопеда дефектолога.

Прививки от гриппа детям

Перед тем как провести вакцинацию, педиатр осматривает ребенка, измеряет температуру тела, определяет величину шейных лимфоузлов.

СРК: причины, симптомы

Сеть медицинских клиник «IMMA» предлагает записаться на прием к опытному специалисту-гастроэнтерологу. Каждая из наших клиник укомплектована высококачественным диагностическим оборудованием, позволяющим максимально точно определить заболевание каждого пациента. Удобное расположение клиник позволит вам посетить врача рядом с домом или работой.

Миома матки

Медицинские клиники IMMA предлагают пройти полное гинекологическое обследование и выявить патологические образования, в частности миому матки, на самых ранних этапах формирования.

Микроскопические исследования мазков – Диагностика Плюс

Мазок на флору (общий мазок, бактериоскопия) – это лабораторное микроскопическое исследование, которое позволяет определить характер микрофлоры влагалища, канала шейки матки или уретры (мочеиспускательного канала) у женщин и уретры (мочеиспускательного канала) у мужчин.

Взятие мазка — простая и безболезненная процедура. Содержимое мазков наносится на предметное стекло, которое затем поступает в лабораторию, где материал анализа окрашивают по специальной методике и рассматривают в микроскоп.

Исследование у женщин и мужчин:

  • Состав микрофлоры исследуемой области мужчины.
  • Присутствие вредоносных бактерий, которые могут способствовать образованию гнойных процессов в организме.
  • Определять развитие воспалительных процессов в исследуемой области.
  • Определять наличие венерических заболеваний по тому показателю, который определяет присутствие в организме возбудителей данных типов заболеваний.
  • Определять любые вредоносные микроорганизмы, в том числе и грибки.

Мазок на флору из уретры у мужчин является основным методом определения наличия и численности разных микроорганизмов в мочеиспускательном канале. Также с его помощью можно выявить воспаление, вызванное присутствующими микроорганизмами.

Он берется, когда пациент приходит на обычный осмотр к урологу или с целью выяснения причин появления выделений, боли, сыпи на половых органах. Мазок на флору из уретры у мужчин дает оценку общего состояния мочеполовой системы, помогает выявить наличие или отсутствие воспалительного процесса.

Исследование у женщин:

Как и остальные среды организма, контактирующие с внешней средой (например полость рта, нос), влагалище здоровых женщин не является стерильным, а заселено многочисленными микробами, которые формируют так называемую нормальную микрофлору влагалища. Основным компонентом нормальной флоры влагалища являются лактобациллы (палочки Дедерлейна) – микроскопические бактерии, вырабатывающие перекись водорода и поддерживающие внутри влагалища кислую среду. Выраженная кислая среда влагалища сдерживает рост болезнетворных бактерий. Таким образом, полезная микрофлора защищает влагалище от микробов, которые могли бы спровоцировать болезнь. Кроме палочек Дедерлейна, во влагалище здоровых женщин могут быть обнаружены незначительные количества стафилококков, стрептококков, грибков из рода Кандида, а также уреаплазм.

На фоне различных гинекологических заболеваний (в том числе в случае заболеваний передающихся половым путем), состав микрофлоры влагалища может измениться, а по характеру его изменения можно установить причину болезни. Состав микрофлоры влагалища определяет и состав микрофлоры двух прилежащих к нему органов – шейки матки и мочеиспускательного канала.

  СТОИМОСТЬ  ПОДГОТОВКА  ЗАПИСАТЬСЯ

U (0-1), V(0-1-2),C (3-4). п…

  • Выберите клинику из списка

  • Все клиники

  • Гинекологическое отделение

  • Центр вспомогательных репродуктивных технологий (ЭКО)

  • Родовое отделение

  • Клиника педиатрии

  • Клиника терапии

  • Клиника стоматологии, имплантологии и челюстно-лицевой хирургии

  • Клиника кардиологии и сердечно-сосудистой хирургии

  • Клиника неврологии и нейрохирургии

  • Клиника хирургии

  • Клиника травматологии и ортопедии

  • Клиника урологии

  • Клиника онкологии

  • Клиника оториноларингологии

  • Клиника офтальмологии и микрохирургии глаза

  • Клиника пластической и реконструктивной хирургии

  • Лабораторная служба

  •      Лаборатория медицинской генетики

  •      Клинико-диагностическая лаборатория

  • Клиника лучевой диагностики

  • Клиника восстановительного лечения

  • Медицинская помощь на дому

  • Бактериальный вагиноз: новые перспективы в лечении

    Раздел только для специалистов в сфере медицины, фармации и здравоохранения!

    А. А. ХРЯНИН, д.м.н., профессор, Новосибирский государственный медицинский университет Минздрава России; вице-президент РОО «Ассоциация акушеров-гинекологов и дерматовенерологов», Новосибирск,
    О.В. РЕШЕТНИКОВ, д.м.н., в.н.с., Научно-исследовательский институт терапии и профилактической медицины, Новосибирск

    Бактериальный вагиноз — это инфекционный невоспалительный синдром, характеризующийся заменой обычной микрофлоры (преимущественно лактобактерий) на полимикробные ассоциации анаэробов и Gardnerella vaginalis. В последние годы использование методов молекулярной биологии показало, что существует гораздо большее разнообразие микроорганизмов, ассоциированных с бактериальным вагинозом, чем считалось ранее. Клиндамицин зарекомендовал себя как эффекивный и безопасный препарат в лечении бактериального вагиноза в современных условиях.

    Влагалищная флора — это многокомпонентная микроэкологическая система, обеспечивающая защиту всех репродуктивных органов женщин как в обычных условиях, так и при патологии. Основными представителями микрофлоры влагалища в норме являются лактобактерии разных видов (Lactobacillus spp.) и в меньшей степени бифидобактерии и коринебактерии, а также анаэробные грамотрицательные палочки рода Fusobacterium и грамотрицательные кокки рода Veillonella. У здоровых женщин репродуктивного возраста ведущее место в вагинальном микроценозе занимают лактобактерии (анаэробного и аэробного происхождения), объединенные под общим названием «палочки Дедерлейна», которые составляют более 95% всей микрофлоры влагалища. Бифидобактерии, так же как и лактобактерии, защищают слизистую оболочку влагалища от воздействия не только патогенных, но и условно-патогенных микроорганизмов, их токсинов, препятствуют распаду секреторного IgА, стимулируют образование интерферона и выработку лизоцима. У здоровых женщин анаэробная микрофлора превалирует над аэробной в соотношении 10 : 1 [1, 2].

    Лактобациллы перерабатывают гликоген, который в большом количестве содержат эпителиальные клетки влагалища женщин репродуктивного возраста, в молочную кислоту, повышая кислотность влагалища. Кроме того, лактобациллы продуцируют перекись водорода. В результате кислая среда влагалища и перекись водорода подавляют рост условно-патогенных микробов (стафилококков, стрептококков, кишечной палочки, анаэробных бактерий, Gardnerella vaginalis, Mobiluncus spp.), которые в небольшом количестве выявляются во влагалище подавляющего большинства женщин. Если доля лактобацилл снижается, их место в экосистеме занимают условно-патогенные микробы (в первую очередь Gardnerella vaginalis). Таким образом, кислая среда влагалищного содержимого, лактобациллы и факторы защиты, которые они продуцируют, образуют мощнейший естественный барьер на пути проникновения патогенных бактерий, защищая верхние отделы полового тракта женщины.

    Особенностью микрофлоры влагалища является ее изменчивость под действием как экзогенных (использование тампонов, частые влагалищные души и спринцевания, смена полового партнера), так и эндогенных факторов (нейроэндокринные заболевания, сахарный диабет, гипотиреоз). На микроценоз оказывают влияние физиологические и гормональные изменения (пубертатный период, беременность, менопауза), фазы менструального цикла, различные нарушения менструальной функции [3]. Играет также роль использование некоторых медикаментозных препаратов (антибиотики, гормоны) и хирургические вмешательства.

    Бактериальный вагиноз (БВ) (прежнее название – вагинальный дисбактериоз) представляет собой общий инфекционный невоспалительный синдром, связанный с дисбиозом влагалища и сопровождающийся чрезмерно высокой концентрацией облигатно и факультативно анаэробных условно-патогенных микроорганизмов в сочетании с резким снижением количества или отсутствием молочнокислых бактерий в отделяемом влагалища (табл. 1).

     Таблица 1. Экосистема влагалища   
      Микроорганизм   Здоровые женщины  Женщины с БВ
      Общее количество микроорганизмов   <107 микроорганизмов/г
      >109 микроорганизмов/г
      Соотношение аэробы : анаэробы   От 1 : 2 до 1 : 10   Достигает 1 : 100
      Lactobacilli
      Преобладают   Незначительное количество
      Gardnerella vaginalis   Наличие в 5—25%   Наличие в 71—92%
      Mycoplasma hominis   Наличие в 15—30%   Наличие в 63%
      Mobiluncus spp. (факультативный анаэроб)
      Наличие в 0—5% 
      Наличие в 50—70%
      Bacteroides spp. (анаэроб)
      Наличие в 52%   Наличие до 100%
      Peptococcus spp. (анаэроб)
      Наличие в 26%   Наличие до 100%

    При бактериальном вагинозе происходит элиминация лактобацилл, сопровождающаяся колонизацией влагалища анаэробами: Fusobacterium, Mobiluncus, Peptostreptococcus, Gardnerella vaginalis. Несмотря на то что БВ характеризуется своей полимикробной природой, основным запускающим процесс микроорганизмом является Gardnerella vaginalis, факультативно-анаэробная грамотрицательная палочка; именно она определяет главную симптоматику БВ.

    Дело в том, что G. vaginalis обладает уникальной способностью формировать на поверхности урогенитальной слизистой так называемую биопленку. Биопленка (biofilm) — это конгломерат микроорганизмов, расположенных на какой-либо поверхности, клетки которых прикреплены друг к другу. Обычно клетки погружены в выделяемое ими внеклеточное полимерное вещество (внеклеточный матрикс) — слизь. Считается, что 95—99% всех микроорганизмов в естественной среде существуют в виде биопленки. Микроорганизмы образуют биопленку под влиянием ряда факторов, включая клеточное распознавание мест прикрепления к поверхности и наличие питательных или агрессивных веществ, кислорода и т. д. В режиме образования биопленки клетка меняет свое поведение, что обусловливается регуляцией экспрессии генов.

    Именно эта биопленка как цемент или клей притягивает к себе другие микроорганизмы, образуя конгломерат бактерий, в большинстве своем обладающих патогенным, или, по крайней мере, опасным для человека эффектом. Биопленки, как было установлено, состоят в основном из Gardnerella vaginalis, в то время как Atopobium vaginae присутствовал в 80% случаев и составил 40% от массы биопленки. Другие бактерии встречаются намного реже, в т. ч. бактерии, принадлежащие к родам Bacteroides, Corynebacterium, Lactobacillus, Veillonella, Ruminococcus и Streptococcus [4].

    К факторам, способствующим развитию БВ относят:

    — Иммунодефицитные состояния организма (хронические стрессы, заболевания, массивное лечение антибиотиками и цитостатиками, лучевая терапия, сахарный диабет, авитаминоз).
    — Гормональная дисфункция яичников, в т. ч. возрастные гормональные изменения, гормонотерапия.
    — Угнетение факторов местного иммунитета и лактобацилл (влагалищные спринцевания, инородные тела, внутриматочные контрацептивы, использование спермицидов, контрацептивные свечи и кремы, содержащие 9-ноноксинол (Патентекс Овал, Ноноксинол)
    — Массивное инфицирование влагалища, промискуитивные связи.

    Распространенность БВ

    Определить истинную частоту встречаемости БВ не представляется возможным в связи с тем, что у 1/3 женщин это заболевание протекает бессимптомно. В немногочисленных исследованиях установлена распространенность БВ в диапазоне от 3,14% у бессимптомных женщин в возрасте от 18 до 72 лет (скрининг в Нидерландах) до 49% у женщин в возрасте от 13 до 65 лет пациенток кабинета кольпоскопии в США. Большой разброс в представленных показателях распространенности может быть связан с включением различных групп пациентов, демографических вариациях и разных диагностических критериев. В целом по результатам 21 исследования общая распространенность БВ составила 27,1%, при этом особо не отличаясь в развитых (28,0%) и развивающихся (23,5%) странах [5].

    В процессе выполнения Human Microbiome Project методы молекулярной биологии показали, что существует гораздо большее разнообразие микроорганизмов, ассоциированных с БВ, чем это было очевидно с использованием методов культивирования. Для примера приведем список микроорганизмов, ранее неизвестных при БВ: Atopobium vaginae, БВ-ассоциированные бактерии (BVAB-1, BVAB-2 и BVAB-3) из порядка Clostridiales, Megasphaera spp, Leptotrichia spp, Dialister spp, Chloroflexi spp, Olsenella spp, Streptobacillus spp, Shuttleworthia spp, Porphyromonas asaccharolytica [6].

    Эти разнообразные организмы аккумулируются, формируя различные сообщества или профили, которые свидетельствуют, что БВ не единое целое, а синдром переменного состава, вызывающий разнообразие симптомов, различные фенотипические исходы и приводящий к вариабельности ответов на различные схемы антибиотиков. Некоторые организмы или комбинации организмов обладают высокой специфичностью для БВ, так что в будущем использование молекулярного количественного анализа позволит лучше диагностировать каждый подтип BV и подбирать индивидуализированную терапию. Расовая принадлежность женщины и географический регион, а также различные расовые группы в том же географическом регионе имеют существенные различия в том, какой микроорганизм является доминирующим в среде влагалища. В большинстве популяций L. crispatus является доминирующим изолятом, а у белых женщин L. crispatus и/или L. jensenii более распространены, чем любые другие виды Lactobacillus [6].

    Среди афроамериканок в США недавно обнаружено превалирование при БВ грамотрицательных бактерий BVAB1, которые ранее ошибочно воспринимались как Mobiluncus spp. [7].

    В недавнем метаанализе, включившем более 10 000 женщин, доказана связь между БВ и предраковыми состояниями, а именно цервикальной интраэпителиальной неоплазией/дисплазией [5]. Поскольку лишь у меньшинства пациенток, ифицированных ВПЧ, развивается дисплазия шейки матки, изучение цервикального канцерогенеза должно включать наличие дополнительного фактора, способствующего ему. Этим фактором и является БВ. Биохимические изменения в вагинальных выделениях женщин с БВ включают образование продуктов метаболизма, таких как пропионат и бутират, способные повреждать эпителиальные клетки. Кроме того, БВ-ассоциированные анаэробы выделяют летучие амины (особенно путресцин, триметиламин и кадаверин), которые появляются в вагинальной среде после преобразования аминокислот, полученных из-за обилия анаэробов, и формируют в сочетании с нитритами (производимые из нитратов бактерий) нитрозамины. Эти канцерогенные соединения способны образовывать аддукты ДНК и, следовательно, мутагенные события. Локальное накопление нитрозаминов во время эпизодов БВ может способствовать клеточной трансформации в эпителии шейки матки в комплексе с другими онкогенными агентами, такими как ВПЧ-инфекция. Кроме того, у пациенток с БВ и дисплазией отмечен измененный профиль местного иммунитета шейки, а именно оксид азота (NO) и концентрации цитокинов (ИЛ-6, ИЛ-8 и ИЛ-10). Наконец, еще одним важным дополнительным кофактором цервикального канцерогенеза может быть относительное отсутствие перекиси водорода (h3O2), в норме производимой лактобактериями. Это препятствует селективной индукции апоптоза, которая представляет собой ключевой элемент стимулируемой лактобактериями противоопухолевой защиты [5].

    У небеременных женщин наличие БВ связано с повышенным риском инфицирования верхних половых путей неполовыми инфекциями и ИППП, а также ВИЧ-инфекции. При беременности БВ увеличивает риск постабортного сепсиса, раннего выкидыша, привычных выкидышей, позднего выкидыша, преждевременного разрыва мембран, спонтанных преждевременных схваток и преждевременных родов, гистологического хориоамнионита и послеродового эндометрита. В результате аномальная вагинальныя флора может предрасполагать к возрастанию колонизации половых путей, инфильтрации плодных оболочек, микробной инвазии амниотической полости и повреждению плода [6].

    При тщательном наблюдении за 49 женщинами (вагинальные образцы забирали еженедельно во время беременности и ежемесячно после родов) отмечено, что с риском преждевременных родов связано сравнительно большее разнообразие представленных в родовых путях микроорганизмов, а максимальный риск оказался у женщин, в вагинальных выделениях которых было мало лактобактерий, а также микроорганизмов вида Gardnerella spp и Ureaplasma spp. У большинства женщин выявлены послеродовые нарушения вагинальной микробиоты со снижением Lactobacillus spp и увеличением различных анаэробов, таких как Peptoniphilus, Prevotella и Anaerococcus видов. Это нарушение не было связано с гестационным возрастом при родах и сохраняется до 1 года после родов. Полученные данные имеют важные последствия для прогнозирования преждевременного родоразрешения и для понимания потенциального воздействия стойких изменений послеродовой микробиоты на состоянии здоровья матерей, в том числе исходов последующих беременностей в случае короткого интервала между ними [8].

    Лабораторная диагностика БВ

    БВ может быть диагностирован клинически или с использованием комплекса клинических критериев, микроскопических, энзимологических, хроматографических методов, а также с использованием качественных или полуколическтвенных культуральных методов [6].

    В мировой медицинской практике пользуются клинико-лабораторными критериями, предложеными Amsel R. (1983 г.), указанные в таблице 2 [9]. Диагноз бактериального вагиноза считается подтвержденным при наличии трех или четырех признаков из предложенных критериев:

      Таблица 2. Клинико-лабораторные критерии бактериального вагиноза [9]    
      Критерии   №   
      Определение   
      Признак БВ
      Клинический   I   
      Осмотр влагалища зеркалом, кольпоскопия   Обильные гомогенные, бело-серые с неприятным запахом выделения
      Клинико-лабораторный     II   
      Определение рН влагалища индикаторной полоской   рН > 4,5
      III   
      Тест КОН (whiff test) — добавление к выделениям из влагалища в пробирке 10% КОН   Появление специфического запаха
      Лабораторный   IV   
      Микроскопия мазка из выделений из влагалища как нативного препарата или окрашенного по Граму     Обнаружение «ключевых клеток»*
            Примечание: *«Ключевые клетки» — это зрелые эпителиальные клетки с адгезированными на них микроорганизмами (гарднереллой, мобилункусом, грамположительными кокками). Можно получить ложные положительные результаты, выявив эпителиальные клетки с адгезированными на них лактобактериями; в этом случае необходимо произвести микроскопию влагалищных мазков, окрашенных по Граму.

    Диагностически значимым считается наличие хотя бы 3 положительных признаков из 4:

    1.    Клинические проявления.
    2.    Повышение pH отделяемого влагалища > 4,5.
    3.    Положительный аминовый тест (усиление запаха гнилой рыбы при реакции с 10% КОH).
    4.    Критерии микроскопии мазка по Граму: слущенный эпителий в большом количестве, «ключевые клетки» составляют 20% от всех эпителиальных, лейкоциты единичные.

    Самой высокой чувствительностью и специфичностью в диагностике бактериального вагиноза обладает культуральный метод. Его высокая информативность обусловлена качественно-количественными показателями состава микробиоценоза влагалища. Соответственно, при бактериальном вагинозе наблюдается уменьшение количества лактобацилл и повышение содержания условно-патогенной флоры. Недостатки метода: относительная дороговизна и длительность выполнения. Исследование ДНК гарднерелл в соскобах из мест поражения методом ПЦР является важным дополнительным критерием БВ.

    Расширенные критерии диагностики БВ

    1.    Преобладание эпителиальных клеток над лейкоцитами (не более 30 в поле зрения).
    2.    Отсутствие визуальных признаков воспаления.
    3.    Наличие не менее 20% ключевых клеток.
    4.    Обнаружение при иммерсионной микроскопии менее 5 лактобацилл в поле зрения.
    5.    Полимикробная картина мазка (обильная полимикробная кокковая и палочковая Г-/ Г+ флора.
    6.    Повышение бактериальной обсемененности в цитологическом препарате.

    Критерии Нугента (Ньюджента)

    Невысокая чувствительность критериев Амселя и наличие бессимптомных форм бактериального вагиноза заставило искать другие методы и критерии подтверждения диагноза. В конце 80-х гг. Spiegel предложил использовать балльную систему для диагностики бактериального вагиноза с учетом соотношения морфотипов лактобацилл и вагинальной гарднереллы при микроскопии окрашенного по Граму мазка из влагалища. Однако система не прижилась, и только в 1991 г. Nugent RP и соавт. предложили свои лабораторные критерии диагностики бактериального вагиноза (Nugent’s Diagnostic Criteria for Bacterial Vaginosis), которыми до сих пор широко пользуются в мировой медицине [10]. В основе лежит система баллов (очков) от 0 до 7 и их комбинация для диагностики и оценки степени бактериального вагиноза по оценке трех бактериальных морфотипов влагалища (табл. 3):

    А — Лактобациллы — большие грампозитивные палочки (Lactobacillus acidophilus: large gram-positive rods)
    B — Вагинальная гарднерелла и бактероиды — мелкие грамвариабельные и грамотрицательные кокки (Gardnerella vaginalis and Bacteroides species :small gram-variable or gram-negative rods)
    C — Мобилункус — изогнутые грамвариабельные палочки (Mobiluncus species:curved gram-variable rods)

    Таблица 3. Мазок из влагалища окрашивают по Граму и считают отдельно количество выявленных морфотипов под иммерсионной системой микроскопа      
      Баллы   A
    Lactobacilli
      B
    Gardnerella
      C
    Mobiluncus
      0   
      более 30 морфотипов   нет морфотипов
      нет морфотипов
      1   
      5—30 морфотипов   один морфотип   один морфотип
      2   
      1—4 морфотипа
      1—4 морфотипа
      1—4 морфотипа
      3   
      один морфотип
      5—30 морфотипов
      5—30 морфотипов
      4   
      нет морфотипов
      более 30 морфотипов   более 30 морфотипов
            Количество полученных баллов суммируют (A + B + C). 0—3 балла: нормальная микрофлора; 4—6 баллов: промежуточная микрофлора; => 7 баллов: бактериальный вагиноз [10].

    B недавнем исследовании проведено сопоставление критериев Amsel и Nugent, в результате оказалось, что критерии Amsel несколько менее информативны, однако в условиях отсутствия специализированной лаборатории могут быть использованы [11].

    В последние годы мировым научным сообществом разработаны критерии дифференциальной клинико-лабораторной диагностики БВ и других подобных или ассоциированных с ним состояний (заболеваний). Существуют неспецифические проявления, которые могут быть зафиксированы гинекологом с последующим более точным лабораторным анализом (табл. 4) [12].

    Таблица 4. Дифференциальная диагностика синдрома вагинальных выделений (бактериальный вагиноз, вульвовагинальный кандидоз, трихомониаз) [12]      
      Показатели   БВ   
      ВВК   
      Трихомониаз
      Выделения
      Бело-серого цвета, обильные   Творожистые или сметанообразные белого цвета
      Пенистые, желто-зеленого цвета, обильные
      Запах 
      Да   
      Нет   
      Да
      Зуд, жжение, раздражение   Нет   
      Да   
      Да
      Отек, гиперемия 
      Нет
      Да
      Да
      Диспареуния   Нет
      Да
      Да
      pH   > 4,5   ≤ 4,5   > 4,5
      Количество лейкоцитов   Норма   
      Повышенное   
      Повышенное
      Микроскопия мазка по Граму   Ключевые клетки   Грибы   Трихомонады
      Культуральный метод
      Не проводится   Грибы рода Candida 
      Трихомонады
           Примечание. БВ — бактериальный вагиноз, ВВК — вульвовагинальный кандидоз.

    Лечение

    Признание важности БВ и его связи с ИППП и с неблагоприятным репродуктивным прогнозом привело к поиску наилучших и более всеобъемлющих вариантов лечения. Существует широкий круг дифференциальной диагностики при вагинальных выделениях, и успех лечения часто зависит от правильного диагноза, тем не менее большому проценту пациентов терапия проводится без дополнительных специфических тестов.

    Наличие широкого спектра терапевтических возможностей, диагностирующих основные причины вагинита, и отсутствие четкого диагноза у 30% больных даже после дополнительного дорогостоящего обследования, объясняет, почему многие гинекологи используют эти препараты. Неправильный диагноз или отказ диагностировать другие инфекции, связанные главным образом в случаях БВ и инфицировании T. vaginalis, может привести к неадекватному лечению, новому обострению и повторному заражению.

    У небеременных женщин лечение не только устранит вагинальные выделения, но и снизит вероятность возникновения инфекционных осложнений после возможных у каждой женщины аборта и/или операции по удалению матки. Кроме того, лечение БВ за счет восстановления кислой рН во влагалище уменьшает риск инфицирования вирусом иммунодефицита, другими заболеваниями, передающимися половым путем.

    У беременных женщин лечение БВ, наряду с вышеназванными эффектами, способствует снижению риска развития осложнений беременности, а именно преждевременного отхождения околоплодных вод, начала родовой деятельности (схваток) и собственно родов, а также послеродового воспаления внутренней поверхности матки (эндометрита). Лечению должны подвергаться и беременные с бессимптомным течением БВ, особенно в случае наличия угрозы преждевременных родов.

    Препаратом выбора в лечении БВ является клиндамицин

    Это антибиотик группы линкозамидов для местного применения в гинекологии. Механизм действия препарата связан с нарушением внутриклеточного синтеза белка в микробной клетке на уровне 50S-субъединицы рибосом. Оказывает бактериостатическое действие, а в более высоких концентрациях в отношении некоторых микроорганизмов — бактерицидное. Обладает широким спектром действия. Активен в отношении микроорганизмов, вызывающих бактериальные вагинозы:

    •    Gardnerella vaginalis.
    •    Mobiluncus spp.
    •    Bacteroides spp.
    •    Mycoplasma hominis.
    •    Peptostreptococcus spp.

    Клиндамицин  (Далацин). Форма  выпуска: крем  вагинальный  и  суппозитории  вагинальные.  5  г  крема  (1  доза) вагинального 2% и один вагинальный суппозиторий содержат: клиндамицина фосфат 100 мг.

    Фармакокинетика. После   однократного   интравагинального  введения  100  мг  клиндамицина  в  среднем  4%  от  введенной  дозы  подвергается  системной  абсорбции. Cmax  в плазме крови составляет в среднем 20 нг/мл.

    Клинических исследований по применению клиндамицина у женщин в I триместре беременности не проводилось, поэтому применение Клиндацина в I триместре беременности возможно только в том случае, когда ожидаемая польза для матери превышает риск для плода. Применение во II и III триместрах беременности возможно, если ожидаемый эффект терапии превышает потенциальный риск для плода (адекватных и строго контролируемых исследований у беременных женщин не проводили, клиндамицин проходит через плаценту и может концентрироваться в печени плода, однако осложнений у человека не зарегистрировано). В результате исследований не установлено, снижает ли лечение бактериального вагиноза риск таких неблагоприятных исходов беременности, как преждевременный разрыв плодных оболочек, преждевременное начало родов или преждевременное родоразрешение. Категория действия на плод по FDA – B.

    В исследовании, проведенном в Швейцарии, были обследованы 5 377 беременных с симптомами потенциальных акушерских осложнений при сроке 25—37 нед. беременности. Женщины с симптомами были тестированы при помощи культурального исследования на наличие Mycoplasma hominis и Ureaplasma spp. и пролечены клиндамицином в случае положительного результата. В результате лечения существенно уменьшился процент преждевременных родов и респираторных осложнений у новорожденных [13].

    Наши коллеги из Бельгии провели поиск в базах данных PubMed и Web of Science для того, чтобы найти новые подходы в профилактике, лечении и предупреждении рецидивов БВ. В результате оказалось, что основными препаратами в лечении БВ остаются клиндамицин и метронидазол. Интенсивно изучаются другие медикаменты, такие как тинидазол, рифаксимин, нитрофуран, декалинума хлорид, аскорбиновая кислота (витамин С) и молочная кислота. Предполагают, что перспективно использование комбинированного режима, чередующегося и долговременного приема для предупреждения рецидивов. Несомненна и польза параллельного назначения пробиотиков [14].

    В мультицентровом рандомизированном двойном слепом исследовании, проведенном в Германиии, Австрии и Швейцарии, сопоставлены эффективность и переносимость 2% вагинально крема клиндамицина (5 г на ночь в течение 7 дней) и перорального метронидазола (500 мг орально в течение 7 дней) в ведении БВ. Пациентов наблюдали через 5—10 дней и 25—39 дней после завершения лечения. В результате излечение или улучшение было отмечено через 1 месяц у 83% пациентов в группе клиндамицина против 73% в группе метронидазола, побочные эффекты отмечены с равной частотой (12%) в обеих группах [15].

    Недавно в мировой литературе появилось понятие аэробного вагинита. Аэробный вагинит — воспалительное заболевание влагалища, вызванное аэробной микрофлорой при резком снижении или отсутствиии нормальной лактофлоры влагалища. Ранее под термином «аэробный вагинит» подразумевался бактериальный вагинит. В основе аэробного вагинита, как и при бактериальном вагинозе, лежит снижение или отсутствие нормальной лактофлоры влагалища и замена ее на аэробные бактерии. Точные причины и механизм развития аэробного вагинита пока неизвестен. Также неизвестно, почему в одних случаях происходит размножение анаэробной микрофлоры и развитие бактериального вагиноза, а в других заселение влагалища аэробными микроорганизмами и развитие аэробного вагинита. Наиболее часто встречающиеся этиологические агенты аэробного вагинита (Escherichia coli, Enterococcus sp. , бета-гемолитический стрептококк группы А, золотистый стафилококк). В решении этого противоречия оказалось, что вагинальные суппозитории, содержащие канамицин или клиндамицин, показали высокую эффективность в купировании аэробного вагинита у небеременных женщин. Кроме того, клиндамицин (вагинальные суппозитории) в сочетании с пробиотиками оказались лучшим выбором для беременных с аэробным вагинитом, чем метронидазол [16].

    Заключение

    Бактериальный вагиноз — давно известное патологическое состояние женской половой сферы с хорошо разработанными критериями клинической диагностики (Амсела и Нугента). Новые возможности молекулярной диагностики постоянно расширяют наши представления о различных видах свойственной организму и чужеродной микрофлоры, свидетельствуя о разнообразии вагинальной микробиоты у каждой отдельной женщины. При этом выбор оптимального препарата предусматривает клиническую эффективность в отношении большинства патогенных микроорганизмов. Таким препаратом может служить клиндамицин, значимость которого в лечении бактериального вагиноза не вызывает сомнения в последних научных публикациях.

    Литература

    1.    Anderson MR, Klink K, Cohrssen A. Evaluation of vaginal complaints. JAMA, 2004, 291:11:1368–1379.
    2.    Mitchell H. Vaginal discharge – causes, diagnosis, and treatment. BMJ, 2004, 328:7451:1306–1308.
    3.    Хрянин А.А., Решетников О.В. Бактериальный вагиноз: новые представления о микробном биосоциуме и возможности лечения. Медицинский совет, 2014, 17: 128-133.
    4.    Verstraelen H, Swidsinski A. The biofilm in bacterial vaginosis: implications for epidemiology, diagnosis and treatment. Curr Opin Infect Dis, 2013, 26: 86–89.
    5.    Gillet E, Meys JFA, Verstraelen H et al. Association between bacterial vaginosis and cervical intraepithelial neoplasia: Systematic review and meta-analysis. Plos One, 2012, 7, Issue 10 e45201.
    6.    Lamont RF, Sobel JD, Akins RA et al. The vaginal microbiome: New information about genital tract flora using molecular based techniques BJOG, 2011, 118(5): 533–549.
    7.     Muzny CA, Sunesara IR, Griswold ME et al. Association between BVAB1 and high Nugent scores among women with bacterial vaginosis. Diagn Microbiol Infect Dis., 2014 December, 80(4): 321–323.
    8.    Di Giulio DB, Callahan BJ, McMurdie PJ et al. Temporal and spatial variation of the human microbiota during pregnancy Proceedings of the National Academy of Sciences 2015/ www.pnas.org/cgi/doi/10.1073/pnas.1502875112.
    9.    Amsel R, Totten PA, Spiegel CA, et al. Nonspecific vaginitis. Diagnostic criteria and microbial and epidemiologic associations. Am J Med, 1983, 74(1): 14–22.
    10.    Nugent RP, Krohn MA, Hillier SL. Reliability of diagnosing bacterial vaginosis is improved by a standardized method of gram stain interpretation. J Clin Microbiol, 1991, 29(2): 297–301.
    11.    Mohammadzadeh F, Dolatian M, Jorjani M, Alavi Majd H. Diagnostic value of Amsel’s clinical criteria for diagnosis of bacterial vaginosis. Glob J Health Sci., 2014 Oct 29, 7(3): 8-14.
    12.    Workowski KA. Sexually transmitted diseases treatment guidelines, 2010. MMWR Recommend Rep 2010; 59:61–63.
    13.    Vouga M, Greub G, Prodhom G, et al. Treatment of genital mycoplasma in colonized pregnant women in late pregnancy is associated with a lower rate of premature labour and neonatal complications. Clin Microbiol Infect, 2014 Oct, 20(10): 1074-9.
    14.    Donders GG, Zodzika J, Rezeberga D. Treatment of bacterial vaginosis: what we have and what we miss. Expert Opin Pharmacother, 2014 Apr, 15(5): 645-57.
    15.    Fischbach F, Petersen EE, Weissenbacher ER, et al. Efficacy of clindamycin vaginal cream versus oral metronidazole in the treatment of bacterial vaginosis. Obstet Gynecol, 1993 Sep, 82(3): 405-10.
    16.    Han C, Wu W, Fan A, Wang Y, Zhang H, Chu Z, Wang C, Xue F. Diagnostic and therapeutic advancements for aerobic vaginitis. Arch Gynecol Obstet, 2015 Feb, 291(2): 251-7.

    Микроскопическое исследование мазка из уретры у мужчин

    Микрофлора мужчин значительно отличается от микрофлоры женщин, что, конечно, связано c различным строением половых путей. Особое значение имеет тот факт, что мужская половая система одновременно является мочевыделительной, поэтому биоценоз уретры зависит от множества факторов.

    Обращение мужчин к урологу в большинстве случаев связано с наличием жалоб: жжение при мочеиспускании, дискомфорт, зуд, появление патологических выделений. К сожалению, планово к урологу, андрологу обращаются единицы. Также, к большому сожалению, существует неверное представление о том, что обследование партнерши одновременно подразумевает исключение таких же возбудителей у партнера. Очень часто на приеме у гинеколога женщины просят одновременно посоветовать препараты для лечения партнера, учитывая лишь результаты проведенного гинекологического обследования. Мы еще раз обращаем внимание на тот факт, что микрофлора мужчин и женщин абсолютно разная, и единственное, что может одновременно присутствовать у обоих партнеров — это инфекции, передаваемые половым путем.

    Микроскопическое исследование мазка из уретры помогает исключить наличие воспаления и лишь некоторых инфекций. Оно представляет собой оценку полученного материала из уретры после предварительного окрашивания мазка. Следует понимать, что данное исследование позволяет оценить лишь некоторые параметры, а именно:

    • Наличие лейкоцитов. Это клетки воспаления, которые в небольшом количестве могут быть, но при превышении нормы свидетельствуют о некой инфекции, которая стала причиной воспалительной реакции.
    • Эритроциты в норме не обнаруживаются, но их присутствие возможно при наличии заболеваний мочеполовой системы, а также при нарушении правил забора материала (например, мазок получен при помощи цитощетки).
    • Слизь и эпителиальные клетки являются нормальными составляющими и отражают процессы регенерации клеток, при этом в мазке они могут присутствовать в небольшом количестве.
    • Морфотипы, то есть форма и количество обнаруженных бактерий. У мужчин преобладают кокки, в отличие от женщин, у которых в норме преобладают палочки.
    • Инфекции, которые можно исключить при проведении данного анализа: трихоманиаз, гонорея и кандидоз. Следует обратить внимание, что микроскопическое исследование не может рассматриваться как абсолютная диагностика данных инфекций, так как не происходит оценка наличия ДНК возбудителя, а оценивают лишь косвенные признаки бактерий — форма, подвижность.

    Основная цель обычно — исключить воспаление уретры. Но при повышенном количестве лейкоцитов и отсутствии перечисленных выше инфекций (трихоманиаз, гонорея, молочница), говорить о возбудителе невозможно. По наличию большого количества кокков, что также указывает на развитие воспалительной реакции, также нельзя определить конкретную флору. При этом не стоит забывать, что микрофлора уретры представлена по большей части эпидермальным стафилококком, который относится к условно-патогенной флоре, но в определенных условиях может чрезмерно расти и приводить к уретриту. Также нормальной микрофлорой уретры является уреаплазма, но ее внутриклеточное существование не позволяет оценить ее количество в мазке на флору, поэтому данный метод исследования может рассматриваться лишь как первоначальный этап. Если выявлены те или иные отклонения от нормы, то потребуется дополнительная диагностика, а именно исследование соскобов из уретры при помощи ПЦР, посев на флору с определением чувствительности к антибиотикам.

    Грам палочки в мазке у женщин: норма, что это такое?

    При заболеваниях репродуктивной системы у женщин, как правило, обнаруживают грам палочки в мазке.

    Гинекологи настоятельно рекомендуют всем женщинам сдавать мазок на флору в целях профилактики различных заболеваний.

    В том случае, когда у женщины появляются жалобы на дискомфорт и боли внизу живота, мазок берется в первую очередь. Очень важно своевременно и правильно расшифровать полученные результаты.

    Особенности микрофлоры

    В человеческом организме постоянно проживает значительное количество различных микроорганизмов. Их присутствие обеспечивает нормальное функционирование всех систем и органов.

    Микроорганизмы, такие как палочки и кокки, находятся в слизистых оболочках рта, носа, кишечника, а у женщин еще и во влагалище.

    При нормальном состоянии, когда иммунная система исполняет свои функции в полном объеме, сохраняется равновесие между полезными и патогенными палочками.

    В клетках слизистой оболочки содержится гликоген, который служит питанием для бактерий. В зависимости от формы, микроорганизмы определяются как палочки и кокки, имеющие положительную или отрицательную грам реакцию.

    В современной гинекологии мазок считается одним из методов, позволяющих выявить патологию женской репродуктивной системы. Микрофлора женского полового органа включает в основном лактобактерии или грам палочки.

    Все обитающие во влагалище у женщин палочки подразделяются на следующие группы:

    • облигатные;
    • транзиторные;
    • факультативные.

    К числу облигатных палочек относятся те, которые постоянно, в необходимом количестве, присутствуют в слизистой оболочке женского полового органа. Палочки создают защитный барьер, препятствующий проникновению патогенных микроорганизмов.

    К числу транзиторных кокков и палочек относятся те, которые попадают на слизистую оболочку влагалища случайно. Среди таких представителей могут оказаться и полезные, и нейтральные, и патогенные виды.

    Грам палочки, которые исследуются после взятия мазка, несут информацию о свойствах микроорганизма.

    Факультативные микробы встречаются не у всех женщин и это своего рода норма. Качественный состав микрофлоры зависит от нескольких факторов.

    Изменения происходят в период менструации, с возрастом и при заболеваниях половой сферы. Наблюдается четкая зависимость от климата, интимной гигиены и состояния иммунитета.

    Физиология женской половой системы устроена таким образом, что на стенках влагалища в основном живут и развиваются лактобактерии и бифидобактерии.

    У женщин при здоровом состоянии эти палочки формируют кислую среду во влагалище. В закисленной среде размножение и развитие других бактерий становится невозможным.

    Благодаря такому защитному механизму во влагалище сохраняется здоровая среда. Важной особенностью палочек является способность прочно закрепляться в слизистой оболочке, создавая надежный барьер для патогенных бактерий.

    Мазок, когда его берут у женщин в профилактических целях, почти всегда показывает положительную грам реакцию.

    При нарушении нормального состояния микрофлоры, появляется и развивается дисбактериоз влагалища.

    Болезнетворные палочки и кокки встречаются в значительном количестве. Соответственно, грам палочки в мазке будут иметь отрицательный знак.

    К такому состоянию, как правило, приводит гормональный дисбаланс, длительное лечение антибиотиками, инфекционные заражения и несоблюдение гигиенических правил.

    Дисбактериоз нередко развивается и при ослаблении иммунной системы. Лечение проводится индивидуально и только после того, как гинеколог возьмет мазок и правильно поставит диагноз.

    Мазок на микрофлору

    Согласно действующим рекомендациям гинекологов, женщине необходимо посещать смотровой кабинет не реже одного раза в полгода.

    Такой режим позволяет своевременно обнаружить возникающие отклонения и заболевания, которые могут возникнуть у женщин в мочеполовой системе.

    Гинекологический мазок считается одним из простых и эффективных способов получить исходный биологический материал для исследования.

    Взятие анализа занимает минимум времени, не представляет никакой опасности для здоровья. Процедура совершенно безболезненна.

    Мазок берется даже у женщин в период беременности. Данные анализа дают врачу необходимый объем информации для предварительного диагноза.

    Гинекологи рекомендуют женщинам, планирующим беременность, или тем, кто прошли длительное лечение сильными препаратами на основе антибиотиков, сделать мазок на флору.

    Процедура проводится в обязательном порядке при появлении у женщин следующих симптомов:

    • периодические боли в животе;
    • выделения с неприятным запахом и необычным цветом;
    • регулярный зуд в районе половых органов.

    Грам палочки в любом мазке несут конкретную информацию о качестве микрофлоры. Одновременно с этим анализ позволяет выявить присутствие заболеваний, передающихся при половых контактах.

    Норма содержания тех или иных микроорганизмов рассчитана опытным путем. Когда бактериальный баланс сохраняется, то никаких неприятных и, тем более, болезненных ощущений у женщин не возникает.

    Чтобы определить истинное значение грам палочек в мазке, пациентке необходимо должным образом подготовиться к сдаче анализа.

    Чтобы результаты анализа оказались достоверными, за сутки до назначенного срока необходимо воздержаться от половых контактов, не делать спринцевание и не применять никаких вагинальных препаратов. Специалисты рекомендуют не мочиться перед мазком в течение 2-х часов.

    Мазок для анализа берется с трех участков – влагалище, мочеиспускательное отверстие, шейка матки.

    В бланке расшифровки результатов это представлено следующим образом:

    • V – vagina, влагалище;
    • C – cervix, шейка матки;
    • U – uretra, мочеиспускательное отверстие.

    По действующим правилам, результаты анализа выдаются по каждой точке отдельно. Образцы слизистой оболочки, в которых присутствуют и грам палочки, берутся с помощью специального шпателя.

    Мазок помещается на специальные приспособления, которые имеются в лаборатории, и отправляется на исследование. Результаты женщина может получить на следующий день.

    Обработка полученных данных

    Полученную в результате лабораторного исследования информацию расшифровывает гинеколог. В этом контексте следует отметить, что деление палочек на грам положительные и грам отрицательные выполняется с тех пор, как биолог с фамилией Грам сделал свое открытие.

    Смысл открытия заключается в том, что различные микроорганизмы окрашиваются в разные цвета под воздействием одного и того же реагента.

    Грам отрицательные палочки обладают повышенной устойчивостью к воздействию антибиотиков. Это свойство объясняется их толстой оболочкой. Чтобы нейтрализовать такие бактерии, приходится применять более сильные препараты.

    Точность результатов зависит от правильной подготовки к мазку, а точность диагноза определяется квалификацией лечащего врача.

    В составе исследуемого материала могут присутствовать следующие клетки:

    • грам положительные палочки;
    • грибки;
    • лейкоциты;
    • плоский эпителий.

    Грам положительные палочки составляют основу здоровой микрофлоры. Когда в мазке присутствует значительная концентрация таких палочек – это норма.

    Если концентрация палочек снижается, то данный факт оценивается как развитие бактериального вагиноза. Присутствие грибков или их спор служит основанием подозревать первую стадию молочницы.

    Когда в мазке, кроме грам палочки, присутствуют лейкоциты, ничего страшного в этом нет. Лейкоциты являются элементом иммунной системы и необходимы в организме для уничтожения болезнетворных бактерий.

    Однако если число клеток более 30 в поле зрения, то велика вероятность протекания воспалительного процесса во влагалище.

    Об этой же патологии свидетельствует высокое содержание в мазке плоского эпителия и отрицательных грам палочек.

    Клетки эпителия выстилают внутреннюю поверхность влагалища. В том случае, когда развивается вагинит, иммунная система стимулирует повышенную выработку плоского эпителия.

    Чистота влагалища

    Определить концентрацию грам палочек в мазке очень важно. Если действующая норма не нарушена, то причин для серьезного беспокойства у женщины нет.

    При наличии отклонений, которые зафиксированы в результатах анализа, гинеколог оценивает сложившуюся ситуацию и ставит соответствующий диагноз.

    Чаще всего диагностируется бактериальный вагиноз. Коварство этого заболевания в том, что протекает оно без видимых симптомов. Иногда вагиноз по ошибке принимают за молочницу.

    Каждой женщине надо знать, что это два совершенно разные заболевания: и методики лечения, и препараты используются разные.

    Если своевременно не лечить бактериальный вагиноз, то болезнь переходит в хроническую форму. В конечном итоге это приводит к серьезным осложнениям, вплоть до бесплодия.

    Появление вагиноза сопровождается следующими признаками:

    • выделения из влагалища белого или светло-серого цвета;
    • постоянный зуд в половых органах;
    • болевые ощущения при мочеиспускании и половом контакте.

    Присутствие грам палочек и других бактерий в мазке служит ориентиром при назначении курса лечения бактериальных патологий. На основе полученных данных специалист определяет уровень чистоты влагалища.

    Для первого уровня чистоты характерен оптимальный бактериальный баланс. Второй уровень характеризуется присутствием не только грам палочек, но и кокковых организмов и дрожжевых грибков.

    Видео:

    На третьем уровне количество лейкоцитов увеличено, при этом количество грам палочек минимально. Высока концентрация патогенных бактерий.

    На четвертом уровне лейкоцитов очень много, и вся микрофлора представлена болезнетворными бактериями. По сути дела, это острый воспалительный процесс.

    В такой ситуации требуется безотлагательное лечение, иначе здоровью женщины грозит серьезная опасность.

    Дополнительные виды исследования

    На практике нередко случается, что мазок на микрофлору показывает нормальный результат, однако у женщин проявляются определенные симптомы, которые нельзя оставить без внимания.

    Несмотря на то, что норма грам палочек соблюдается, во влагалище присутствуют представители патогенной микрофлоры.

    Причина такого состояния заключается в том, что некоторые микробы, такие как хламидии, из-за малых размеров невозможно рассмотреть в микроскоп.

    Чтобы зафиксировать подобные микроорганизмы, необходимо использовать более чувствительные методы исследования. С этой целью проводится биохимическое исследование крови.

    При исследовании мазка на присутствие грам палочки и других бактерий, выполняется бактериологический посев. С помощью этой процедуры определяется основной возбудитель инфекции, его концентрация во влагалище.

    Бактериологический посев в обязательном порядке выполняется:

    • при постановке на учет всем беременным женщинам;
    • при воспалениях и нарушениях микрофлоры;
    • при подозрении на гонококковую инфекцию.

    Следует отметить, что посев производится и после завершения определенного курса лечения в том случае, когда использовались препараты на основе антибиотиков. Как правило, исследование назначается через неделю после завершения лечения.

    Одновременно с бактериологическим посевом мазка на грам палочки определяется чувствительность микроорганизмов к воздействию антибиотиков.

    На сегодняшний день в распоряжении лечащего врача имеется большой набор антибиотических препаратов.

    Болезнетворные палочки, которые поселяются во влагалище у женщин, обладают разной восприимчивостью к воздействию этих лекарств.

    Видео:

    Лечебная практика показывает, что лечение антибиотиками определенной группы не всегда приводит к положительным результатам. Происходит это потому, что препарат выбирался без учета особенностей микрофлоры влагалища.

    Присутствие грам палочки в мазке у женщин не всегда свидетельствует об отсутствии патологии. Большое количество патогенных кокков и палочек обладают способностью мимикрировать и долгое время не обозначать своего присутствия в определенной среде.

    Специалистам об этих особенностях давно и хорошо известно. Чем коварнее патогенная палочка, тем точнее должна быть диагностика и радикальнее лечение.

    Чтобы избежать серьезных неприятностей, женщинам в любом возрасте необходимо строго соблюдать правила интимной гигиены, воздерживаться от случайных половых контактов, периодически сдавать мазок на флору и правильно питаться.

    Вы здесь:

    Надежность традиционного мазка Папаниколау в диагностике бактериального вагиноза у женщин с клиническими генитальными инфекциями

    Рак в Южной Азии. 2020 январь-март; 9 (1): 13–16.

    Кавита Вивек Ананд

    Отделение профилактической онкологии, Мемориальный центр Тата, при Национальном институте Хоми Бхабха, Мумбаи, Махараштра, Индия

    Шармила Анил Пимпл

    Отделение превентивной онкологии Национального института Татахаба при Национальном институте Хоми, филиал Хоми , Мумбаи, Махараштра, Индия

    Гаурави А.Мишра

    Отделение профилактической онкологии, Мемориальный центр Тата, филиал Национального института Хоми Бхабха, Мумбаи, Махараштра, Индия

    Рупали В. Сахаре

    1 Отделение микробиологии, Больница общего профиля имени Р. Н. Купера, Мумбаи, Индия

    Салим Патутара

    2 Отделение цитопатологии, Мемориальная больница Тата, Мумбаи, Махараштра, Индия

    Кедар К. Деодхар

    3 Отделение патологии, Мемориальная больница Тата, Мумбаи, Махараштра, Индия

    С.Шастри

    4 Департамент исследований неравенства в отношении здоровья, Отдел профилактики рака и демографических исследований, Онкологический центр доктора медицины Андерсона, Хьюстон, США

    Отдел профилактической онкологии, Мемориальный центр Тата, филиал Национального института Хоми Бхабха, Мумбаи, Махараштра, Индия

    1 Отделение микробиологии, Больница общего профиля имени Р. Н. Купера, Мумбаи, Махараштра, Индия

    2 Отделение цитопатологии, Мемориальная больница Тата, Мумбаи, Махараштра, Индия

    3 Отделение патологии, Мемориальная больница Тата , Мумбаи, Махараштра, Индия

    4 Департамент исследований неравенства в отношении здоровья, Отдел профилактики рака и демографических исследований, Онкологический центр доктора медицины Андерсона, Хьюстон, США

    Авторские права: © 2019 Южноазиатский журнал рака

    Это открытый доступ журнал, а статьи распространяются на условиях Creative Commons Attribution-NonCommercial- ShareAlike 4.0, которая позволяет другим создавать ремиксы, настраивать и развивать работу в некоммерческих целях, при условии предоставления соответствующего кредита и лицензирования новых творений на идентичных условиях.

    Реферат

    Цель:

    Бактериальный вагиноз (БВ) — распространенная инфекция репродуктивного тракта (ИРО), о которой сообщают среди индийских женщин. БВ может влиять на сохранение онкогенного вируса папилломы человека высокого риска, причинного фактора рака шейки матки. БВ и рак шейки матки являются серьезными проблемами общественного здравоохранения в такой развивающейся стране, как Индия.Для такой страны с ограниченными ресурсами, как Индия, с ограниченным доступом к здравоохранению, становится важным внедрить меры контроля для скрининга и лечения ИРО в попытке предотвратить риск рака шейки матки. Мазок Папаниколау (Пап) является общепринятым инструментом скрининга рака шейки матки, а диагностика ИРО является частью его оценки. Настоящее исследование исследует валидность обычного мазка Папаниколау для диагностики БВ.

    Методология:

    Пап-мазок и мазок, окрашенный по Граму, были взяты у 254 женщин с клинически очевидным цервицитом / цервиковагинитом (генитальная инфекция).Используя оценку Nugent по окраске по Граму в качестве золотого стандарта, мы определили чувствительность и специфичность мазка Папаниколау для диагностики BV.

    Результаты:

    Общая распространенность БВ в исследуемой популяции составила 44% по шкале Ньюджента. Мазок Папаниколау показал чувствительность и специфичность 70,9%. (ДИ — 61,5–79,2%) и 56,8% (ДИ — 48,2–65,2%) соответственно. Положительная прогностическая ценность мазка Папаниколау для диагностики БВ составила 56,5% (ДИ — 47,8–64,9%), а прогностическая ценность отрицательного результата — 71.2% (ДИ — 61,8–79,4%).

    Заключение:

    В настоящем исследовании обычный мазок Папаниколау демонстрирует хорошую точность для определения BV. Пап-тест для скрининга рака шейки матки может дополнительно служить эффективным инструментом скрининга для диагностики БВ среди женщин с генитальной инфекцией в медицинских учреждениях.

    Ключевые слова: Бактериальный вагиноз, цервицит, вирус папилломы человека, оценка по шкале Ньюджента, мазок Папаниколау

    Введение

    Среднесрочный отчет Национальной организации по контролю за СПИДом (NACO), Индия, который был основан на обзоре опубликованных и неопубликованных популяций Исследования, основанные на исследованиях, показали, что бактериальный вагиноз (БВ) является наиболее распространенной инфекцией половых путей (ИРО) среди индийских женщин.[1] Во всем мире регистрируется огромное бремя симптоматического / бессимптомного БВ. [2,3] Появляются доказательства тесной связи между цервицитом и БВ. [4,5]

    Инфекция БВ требует внимания, поскольку она имеет может вызвать материнскую заболеваемость из-за связи с такими распространенными заболеваниями, как воспалительные заболевания органов малого таза, хориоамнионит и преждевременные роды у женщин. [6] Из-за изменения микробиологической флоры влагалища и воспаления, связанного с BV, он может помочь в приобретении и передаче инфекции вируса папилломы человека (HPV), которая является основной причиной рака шейки матки.Воспаление шейки матки вызывает разрыв эпителия шейки матки, помогая ВПЧ проникать в активно пролиферирующие базальные клетки эпителия шейки матки. [7] Известно, что воспаление вызывает повреждение ДНК клетки-хозяина, что приводит к интеграции вирусной ДНК, что приводит к постепенному прогрессированию инфекции ВПЧ до микроинвазии и инвазивного рака шейки матки. БВ может служить кофактором устойчивости ВПЧ высокого риска, поэтому диагностика и лечение инфекции БВ может помочь снизить риск рака шейки матки у женщин.[8,9,10,11,12]

    Мазок Папаниколау (Пап) помимо установленного скринингового теста для выявления предраковых поражений шейки матки также предназначен для диагностики инфекций, передаваемых половым путем (ИППП) / инфекций, передаваемых репродуктивным путем (ИРО). 13] Мазок по Папаниколау может стать экономически эффективным инструментом для двойного скрининга на БВ и рак шейки матки, которые являются наиболее частой причиной заболеваемости и смертности среди индийских женщин. [1,14] Среди ИРТ роль мазка по Папаниколау. по диагностике BV получены противоречивые результаты, полученные в нескольких развитых и развивающихся странах.[3,15,16,17,18,19,20] Имеются ограниченные данные из Индии о точности мазка Папаниколау при обнаружении BV. Насколько нам известно, единственное исследование на уровне общины, проведенное в Индии, продемонстрировало обнадеживающие результаты мазка Папаниколау для диагностики инфекции BV с чувствительностью 78% [3]. В настоящем исследовании оценивается точность мазка Папаниколау для диагностики инфекции BV у женщин с клинически очевидной генитальной инфекцией с использованием шкалы Nugent по мазку, окрашенному по Граму, в качестве золотого стандарта. [21,22,23] Оценка микробиологии для диагностики инфекции BV с помощью Оценка Nugent, проведенная для женщин, включенных в настоящее исследование, является частью основного исследования, в котором изучается «Выполнение теста ДНК ВПЧ при наличии коинфекции с распространенными ИРО».

    Методология

    Дизайн исследования представляет собой проспективное слепое перекрестное исследование женщин репродуктивной возрастной группы, поступивших на плановый скрининг рака шейки матки в институт третичной медицинской помощи в период с августа 2016 года по август 2018 года.

    Критерии включения в исследование были небеременными женщинами в возрастной группе 30–50 лет с клинически очевидным цервицитом / цервиковагинитом (генитальной инфекцией) при осмотре зеркала. Определение случая цервицита — нездоровая шейка матки с наличием эритемы шейки матки и воспаления, которое кровоточит при прикосновении со слизисто-гнойными / гнойными выделениями.Среди 3900 женщин, посетивших отделение онкологического скрининга в период с августа 2016 года по август 2018 года, 2407 небеременных женщин в возрастной группе 30–50 лет прошли скрининг на соответствие критериям клинически очевидной генитальной инфекции при осмотре зеркала. Двести пятьдесят четыре женщины, которые соответствовали критериям отбора, были допущены к участию в исследовании.

    Затем женщин опросили для выяснения социально-демографических данных, репродуктивного анамнеза, истории болезни и симптомов, относящихся к ИППП / ИРО, таких как белые выделения из влагалища, боли внизу живота, жжение при мочеиспускании, диспареуния и посткоитальное кровотечение.Информация была собрана в предварительно структурированной проверенной проформе.

    Мазки выделений из шейки матки и влагалища для окрашивания по Граму с последующим взятием мазка Папаниколау были взяты у всех женщин, включенных в исследование. Все женщины прошли курс лечения от генитальной инфекции (инфекций).

    Обычные мазки Папаниколау были получены с использованием стерилизованных, увлажненных тампонов с ватным наконечником по стандартной процедуре в рамках стандартного скринингового теста на рак шейки матки. Мазок Папаниколау был взят из зоны трансформации, боковой стенки влагалища и эндоцервикса.Отделение цитопатологии оценило мазки Папаниколау системой Bethesda 2014. [13] Цитолог был не осведомлен о клинических результатах осмотра в зеркалах и шкале Ньюджента при окрашивании по Граму.

    Критерии мазка Папаниколау для диагностики БВ: «отдельные плоские клетки покрыты слоем коккобацилл, которые скрывают клеточную мембрану, образуя так называемые ключевые клетки. Наличие большого количества воспалительных клеток, представляющих вагинит, с явным отсутствием лактобацилл »[].

    Мазок Папаниколау, показывающий поверхностные и промежуточные плоские эпителиальные клетки, усыпанные коккобациллами, что дает характерный «ключ-ключ» для диагностики бактериального вагиноза (Папаниколау, × 200)

    Для сбора выделений для окрашивания по Граму использовали стерильный мягкий тампон с ватным наконечником. . Цервиковагинальный мазок собирали, вставляя тампон с ватным наконечником в эндоцервикс и вращая его для сбора эндоцервикального отделяемого, а у всех женщин, включенных в исследование, собирали влагалищные выделения из задних сводов и боковых стенок влагалища.Разряд равномерно растекался по предметному стеклу. Мазки были зафиксированы нагреванием и переданы в отделение микробиологии сотрудничающего института для окрашивания и оценки по Граму. Микробиолог не знал результатов мазка Папаниколау и результатов клинического осмотра в зеркалах.

    Стекла, окрашенные по Граму, оценивали на BV с использованием балльной системы Nugent. Слайды считывали при × 1000 с использованием масляной иммерсии. Оценка Nugent использует систему баллов, назначенных количеству различных бактерий, присутствующих в образце, различной бактериальной морфологии и количеству присутствующих лактобацилл.Баллы варьируются от 0 до 10. Общий балл 0–3 считается нормальной микрофлорой влагалища, балл 4–6 классифицируется как промежуточная флора, а балл 7–10 считается совместимым с диагнозом: BV.

    Этическое разрешение

    Основное исследование было совместным исследованием между отделением микробиологии городской больницы общего профиля и отделением онкологической диагностики онкологической больницы третичного уровня. Протокол исследования был рассмотрен и одобрен комитетами по институциональной проверке и этике участвующих центров.

    Статистический анализ

    Данные были собраны и проанализированы с использованием статистического пакета для социальных наук (SPSS-v24) для частотного распределения. Характеристики теста с точки зрения чувствительности, специфичности, положительной прогностической ценности (PPV) и отрицательной прогностической ценности (NPV) мазка Папаниколау были рассчитаны с использованием Stata 13.0.

    Результаты

    Всего в исследовании приняли участие 254 женщины с клинически очевидной генитальной инфекцией при осмотре зеркала.Средний возраст женщин составил 38 лет. Среди женщин, включенных в исследование, 204 (80,3%) женщины имели симптомы ИППП / ИРО, тогда как 50 (19,7%) не имели симптомов. Сто двенадцать (44,1%) женщин были диагностированы БВ по шкале Ньюджента, тогда как мазок Папаниколау выявил БВ у 138 (55,4%) женщин [].

    Таблица 1

    Распространенность бактериального вагиноза среди женщин с клинически очевидной генитальной инфекцией

    Клинические симптомы и результаты диагностики n = 254, n (%)
    Клинические симптомы цервита
    Симптоматическое 204 (80.3)
    Бессимптомно 50 (19,7)
    Диагноз БВ по шкале Ньюджента по окраске по Граму *
    БВ положительный (оценка 7-10) 112 (44,1) BV отрицательный (баллы 0-6) 142 (55,9)
    Диагноз BV с помощью обычного мазка Папаниколау по классификации Bethesda
    BV положительный (изменение флоры, указывающее на BV) 138 (55 .4)
    BV отрицательный 116 (45,7)

    Среди 254 женщин у пяти (2%) женщин мазок Папаниколау был признан неадекватным для оценки. У восьмидесяти девяти (35%) женщин были зарегистрированы нормальные / воспалительные мазки без инфекции. В целом в исследуемой популяции ( n = 254) мазок Папаниколау выявил инфекцию BV у 138 (54,3%) женщин и аномалию эпителиальных клеток у 46 (18,1%) женщин. У 31 (12,2%) женщины из исследуемой популяции была инфекция BV, связанная с аномалиями эпителиальных клеток, о которых сообщалось в мазке Папаниколау.Инфекция Candida или трихомониаз была зарегистрирована у семи (2,8%) женщин [].

    Таблица 2

    Распределение результатов мазка Папаниколау среди женщин с клинически очевидной генитальной инфекцией

    Категория мазка Папаниколау по классификации Bethesda n = 254, n (%)
    Неадекватно для оценки 5 (2)
    Нормальный / воспалительный мазок без инфекции 89 (35)
    Сообщено об общем BV-положительном мазке 138 (54.3)
    Сообщено о полных аномалиях эпителиальных клеток 46 (18,1)
    ASCUS 13 (5,1)
    LSIL 26 (10,2)
    BV с аномалиями эпителиальных клеток (ASCUS, LSIL, HSIL) 31 (12,2)
    Другие единичные ИРО (кандидоз / трихомониаз) 7 (2,8)
    9 баллов по шкале Nug. Диагностируя БВ как золотой стандарт, мазок Папаниколау показал чувствительность и специфичность 70.9% (доверительный интервал [ДИ] — 61,5–79,2%) и 56,8% (ДИ — 48,2–65,2%) соответственно. PPV составлял 56,5% (CI — 47,8–64,9%), а NPV — 71,2% (CI — 61,8–79,4%) [].

    Таблица 3

    Сравнение мазка Папаниколау и критериев Ньюджента для диагностики бактериального вагиноза

    Отчет о мазке Папаниколау Оценка Ньюджента * по окраске по Граму Всего

    10 (положительный)
    Балл 0-6 (отрицательный)
    BV положительный 78 60 138
    BV отрицательный 32 79 111 901 110 139 249

    Обсуждение

    Согласно отчету NACO 2012, распространенность инфекции BV среди индийских женщин колебалась в пределах 17.8% и 63,7%. [1] В данном исследовании распространенность инфекции BV составила 44,1% по шкале Nugent. Около 19,7% женщин не имели симптомов, что указывает на возможность большого количества недиагностированных бессимптомных инфекций половых органов среди индийских женщин []. Инфекция BV может служить кофактором стойкого ВПЧ высокого риска в патогенезе предраковых / раковых поражений шейки матки [9]. Среди исследуемой популяции 18,1% ( n = 46/254) женщин сообщили об аномалиях эпителиальных клеток в мазке Папаниколау [].Среди 46 аномалий эпителиальных клеток (ASCUS и выше), зарегистрированных в мазке Папаниколау, 67,3% ( n = 31/46) пациентов были связаны с инфекцией BV, что свидетельствует о необходимости лечения инфекции BV.

    Мазок Папаниколау — это признанный инструмент скрининга для выявления аномалий эпителиальных клеток, связанных с предраковыми / раковыми поражениями шейки матки. Критерии Амселя и оценка Ньюджента являются двумя наиболее часто оцениваемыми золотыми стандартными методами диагностики инфекции BV. [3,15,17,18,19,24,25,26] Целью настоящего исследования было оценить тестовые характеристики Мазок по Папаниколау как инструмент скрининга для диагностики инфекции BV по шкале Ньюджента 7 и выше.

    Система Bethesda 1991 года для сообщения цервиковагинальной цитологии показала, что преобладание коккобацилл согласуется с изменением микрофлоры влагалища, но этого было недостаточно для диагностики инфекции BV [27]. Позже Prey et al. продемонстрировал, что 96% женщин, показывающих преобладание коккобацилл на мазке Папаниколау, также сообщили об инфекции БВ при окрашивании по Граму [15]. Tokyol et al. в своем исследовании сообщили, что чувствительность и специфичность мазка Папаниколау при диагностике БВ составляет 43.1% и 93,6% соответственно, используя оценку Ньюджента в качестве золотого стандарта [18]. Низкая чувствительность мазка Папаниколау для диагностики инфекции BV может быть связана с оценкой мазка из шейки матки вместо мазка из влагалища для диагностики инфекции BV по окрашиванию по Граму, поскольку BV в первую очередь является вагинальной инфекцией. [19]

    По сравнению с другими исследованиями [17,18,19] настоящее исследование сообщило об улучшении чувствительности на 70,9% и специфичности 56,8% мазка Папаниколау для диагностики инфекции BV. PPV и NPV мазка Папаниколау для диагностики BV составили 56.5% и 71,2% соответственно [].

    Более высокая чувствительность Папаниколау для выявления инфекции BV в настоящем исследовании может быть отнесена в первую очередь к стандартной процедуре выполнения мазка Папаниколау согласно протоколу института, включающему область зоны трансформации, влагалища и эндоцервикса, и, следовательно, тот факт, что Пап-мазок мазок имеет как вагинальный, так и цервикальный компоненты. Во-вторых, женщины, включенные в исследование, имели клинически очевидную генитальную инфекцию при осмотре зеркала, и, таким образом, предполагалось, что частота положительных результатов на БВ среди этих женщин будет высокой.В-третьих, мазки Папаниколау были представлены обученным цитотехнологом из онкологического института третичного уровня с лабораторией, аккредитованной Национальным советом по аккредитации испытательных и калибровочных лабораторий. Причины низкой специфичности мазка Папаниколау для диагностики инфекции BV могут быть связаны, во-первых, с микробиологической микрофлорой влагалища, состоящей из нескольких типов облигатных и факультативных анаэробных бактерий, которые являются комменсальными, включая Gardnerella vaginalis, Peptostreptococcus видов и Bacteroides видов. .[28] Чрезмерный рост вышеупомянутых организмов является основной причиной инфекции BV среди женщин. Шкала Nugent по окрашиванию по Граму имеет стандартную систему баллов, которая учитывает различные бактериальные морфологии вышеупомянутых организмов и их количество, присутствующее в данном высоком поле (HPF) вместе с лактобациллами, чтобы отличить нормальную / промежуточную микрофлору влагалища от BV-инфекция. В мазке Папаниколау, в отличие от шкалы Ньюджента, отсутствует стандартизированная система оценки для определения количества бактерий и лактобацилл, присутствующих в HPF, что является необходимым предварительным условием для диагностики инфекции BV.Стандартная окраска Папаниколау, используемая для мазка Папаниколау при хорошем увеличении линз объектива, может идентифицировать морфологию бактерий (кокки, бациллы и коккобациллы), но имеет ограничения, касающиеся грамположительной / грамотрицательной природы бактерий. Наконец, критерии диагностики бактериальной вагинальной инфекции по мазку Папаниколау, который соответствует «сдвигу вагинальной флоры, наводящему на мысль о БВ», а не «вагиниту», могут быть обусловлены нормальной / промежуточной вагинальной флорой из-за других облигатных и факультативных анаэробных бактерий, присутствующих во влагалищной флоре, явно не доказывает клиническую инфекцию.[29,30]

    Заключение

    BV-инфекция является наиболее частым ИРТ у женщин, зарегистрированным на Индийском субконтиненте. Нежелание со стороны индийских женщин посещать медицинские учреждения для обследования и лечения ИППП / ИРО из-за плохого доступа, недостаточное количество лабораторных диагностических учреждений в условиях программ общественного здравоохранения делает их предрасположенными к инфекциям нижних отделов половых путей. Стойкие нелеченые инфекции половых путей могут повысить восприимчивость к инфекции ВПЧ.Приобретение и сохранение ВПЧ с высоким риском имеют серьезные последствия для канцерогенеза шейки матки. [10,31]

    Мазок Папаниколау в первую очередь является скрининговым тестом на рак шейки матки, однако сообщение об ИППП / ИРО является частью оценки в соответствии с рамки, предоставляемые системой Bethesda для оценки мазков Папаниколау. [13] Поскольку точность диагностики клинической инфекции BV варьируется, и у большинства женщин инфекция BV может протекать бессимптомно, мазок Папаниколау может служить средством диагностики инфекции BV в странах с ограниченными ресурсами, таких как Индия.В настоящем исследовании мазок Папаниколау оказался довольно надежным инструментом для диагностики БВ у женщин с генитальной инфекцией без необходимости дополнительных диагностических тестов или затрат на окрашивание по Граму, что само по себе обычно не проводится в медицинских учреждениях Индии. Таким образом, при наличии возможности сдавать мазок Папаниколау следует использовать для скрининга и оперативного лечения женщин на BV, чтобы снизить заболеваемость, связанную с BV-инфекцией.

    Финансовая поддержка и спонсорство

    Это исследование финансировалось за счет внутреннего финансирования Совета управления исследованиями Мемориального центра Тата.Грант № 1671.

    Конфликт интересов

    Конфликта интересов нет.

    Выражение признательности

    Авторы хотели бы поблагодарить г-жу Савиту Р. Карнад, научного сотрудника отделения микробиологии больницы доктора Р. Н. Купера и доктора Кишора Бизор, профессора и главу отделения микробиологии, доктора Р. Cooper General Hospital, Мумбаи за техническую поддержку рукописи. Мы благодарим доктора Прамода Хараде за поддержку в проведении исследования, г-на С.Г. Рейбхаттанавара за управление точностью данных.

    Ссылки

    3. Содхани П., Гарг С., Бхалла П., Сингх М.М., Шарма С., Гупта С. Распространенность бактериального вагиноза в условиях сообщества и роль мазка Папаниколау в его выявлении. Acta Cytol. 2005; 49: 634–8. [PubMed] [Google Scholar] 4. Марраццо Дж. М., Визенфельд Х. К., Мюррей П. Дж., Буссе Б., Мейн Л., Крон М. и др. Факторы риска цервицита у женщин с бактериальным вагинозом. J Infect Dis. 2006; 193: 617–24. [PubMed] [Google Scholar] 5. Паавонен Дж., Кричлоу К.В., ДеРоуэн Т., Стивенс К.Э., Кивиат Н., Брунхэм Р.К. и др.Этиология воспаления шейки матки. Am J Obstet Gynecol. 1986; 154: 556–64. [PubMed] [Google Scholar] 6. Пейпер Дж. Ф., Монтаньо А. Б., Купер А. С., Сунг С.Дж. Бактериальный вагиноз как фактор риска инфекции верхних отделов половых путей. Am J Obstet Gynecol. 1997; 177: 1184–7. [PubMed] [Google Scholar] 7. Вудман CB, Коллинз SI, Янг LS. Естественное течение инфекции шейки матки ВПЧ: нерешенные вопросы. Нат Рев Рак. 2007; 7: 11–22. [PubMed] [Google Scholar] 8. Нам К. Х., Ким Ю. Т., Ким С. Р., Ким С. В., Ким Дж. В., Ли М.К. и др. Связь между бактериальным вагинозом и цервикальной интраэпителиальной неоплазией.J Gynecol Oncol. 2009; 20: 39–43. [Бесплатная статья PMC] [PubMed] [Google Scholar] 9. Gillet E, Meys JF, Verstraelen H, Verhelst R, De Sutter P, Temmerman M, et al. Связь между бактериальным вагинозом и цервикальной интраэпителиальной неоплазией: систематический обзор и метаанализ. PLoS One. 2012; 7: e45201. [Бесплатная статья PMC] [PubMed] [Google Scholar] 10. Уильямс В.М., Филиппова М., Сото У., Дюрксен-Хьюз П.Дж. Интеграция ДНК ВПЧ и канцерогенез: предполагаемая роль в воспалении и окислительном стрессе. Будущий Virol.2011; 6: 45–57. [Бесплатная статья PMC] [PubMed] [Google Scholar] 11. Международное агентство по изучению рака. Вирусы папилломы человека. Монографии МАИР по оценке канцерогенных рисков для людей. Международное агентство по изучению рака. 1995; 64 [Google Scholar] 12. Уолбумерс Дж. М., Якобс М. В., Манос М. М., Bosch FX, Куммер Дж. А., Шах К. В. и др. Вирус папилломы человека — необходимая причина инвазивного рака шейки матки во всем мире. J Pathol. 1999; 189: 12–9. [PubMed] [Google Scholar] 13. Наяр Р., Уилбур округ Колумбия. Пап-тест и Bethesda 2014.«Сообщения о моей кончине сильно преувеличены». (по цитате Марка Твена) Acta Cytol. 2015; 59: 121–32. [PubMed] [Google Scholar] 15. Prey M. Обычные мазки Папаниколау для диагностики бактериального вагиноза. Diagn Cytopathol. 1999; 21: 10–3. [PubMed] [Google Scholar] 16. Эрикссон К., Форсум У., Бьёрнерэм А., Платц-Кристенсен Дж. Дж., Ларссон П. Г.. Подтверждение использования мазков из влагалища, окрашенных Папаниколау, для диагностики бактериального вагиноза. APMIS. 2007; 115: 809–13. [PubMed] [Google Scholar] 17. Дэвис Дж. Д., Коннор Э., Кларк П., Уилкинсон Э. Дж., Дафф П.Корреляция между результатами цитологического исследования шейки матки и окраской по Граму в качестве диагностических тестов для бактериального вагиноза. Am J Obstet Gynecol. 1997; 177: 532–5. [PubMed] [Google Scholar] 18. Tokyol C, Aktepe OC, Cevriolu AS, Altindiş M, Dilek FH. Бактериальный вагиноз: сравнение результатов мазка Папаниколау и микробиологического анализа. Мод Pathol. 2004; 17: 857–60. [PubMed] [Google Scholar] 19. Карани А., Де Вуйст Х., Лухтерс С., Отиго Дж., Мандалия К., Черсич М.Ф. и др. Мазок Папаниколау для выявления бактериального вагиноза. Int J Gynaecol Obstet.2007; 98: 20–3. [PubMed] [Google Scholar] 20. Грин Дж. Ф., 3-й, Кюль Т. Дж., Аллен С. Р. Мазок Папаниколау: неадекватный скрининговый тест на бактериальный вагиноз во время беременности. Am J Obstet Gynecol. 2000; 182: 1048–9. [PubMed] [Google Scholar] 21. Ван Дж. Бактериальный вагиноз. Обновление Prim Care Ob Gyns. 2000; 7: 181–5. [PubMed] [Google Scholar] 22. Ньюджент Р.П., Крон М.А., Хиллиер С.Л. Надежность диагностики бактериального вагиноза повышается за счет стандартизированного метода интерпретации окраски по Граму. J Clin Microbiol. 1991; 29: 297–301.[Бесплатная статья PMC] [PubMed] [Google Scholar] 24. Платц-Кристенсен Дж. Дж., Ларссон П. Г., Сундстрём Э., Виквист Н. Обнаружение бактериального вагиноза во влажных мазках, мазках из влагалища, окрашенных по Папаниколау, и в мазках, окрашенных по Граму. Acta Obstet Gynecol Scand. 1995; 74: 67–70. [PubMed] [Google Scholar] 25. Вардар Э., Марал И., Инал М., Озгудер О., Тасли Ф, Постачи Х. Сравнение процедур окрашивания по Граму и мазка Папаниколау при диагностике бактериального вагиноза. Заражение Dis Obstet Gynecol. 2002; 10: 203–7. [Бесплатная статья PMC] [PubMed] [Google Scholar] 26.Сиддиг Е.Е., Албари РФ, Мохамед М.А., Эламин Б.К., Эдрис А.М. Бактериальный вагиноз в штате Хартум, Судан: сравнение окрашивания по Граму с процедурами мазка Папаниколау. Afr J Microbiol Res. 2017; 11: 644–8. [Google Scholar] 27. Luff RD. Система Bethesda для регистрации цитологических диагнозов шейки матки / влагалища. Отчет о семинаре Bethesda 1991 года. Am J Clin Pathol. 1992; 98: 152–4. [PubMed] [Google Scholar] 28. Ларсен Б, Мониф ГР. Понимание бактериальной флоры женских половых путей. Clin Infect Dis. 2001; 32: e69–77.[PubMed] [Google Scholar] 29. Джакомини Дж., Паавонен Дж., Рильке Ф. Микробиологическая классификация цервиковагинальной флоры в мазках Папаниколау. Acta Cytol. 1989; 33: 276–8. [PubMed] [Google Scholar] 30. Giacomini G, Schnadig VJ. Мазок Папаниколау из шейки матки: бактериальная инфекция и система Bethesda. Acta Cytol. 1992; 36: 109–10. [PubMed] [Google Scholar] 31. Харсани А.Б., Хусен А.А., Мудли Дж., Багарати Дж., Гоус Э. Связь между патогенами, передающимися половым путем, и цервикальной внутриэпителиальной неоплазией в развивающемся сообществе.Genitourin Med. 1993; 69: 357–60. [Бесплатная статья PMC] [PubMed] [Google Scholar]

    Vaginal Flora

    Здоровая флора влагалища защищает организм от урогенитальных инфекций. Он состоит из множества различных типов бактерий, среди которых преобладают лактобациллы. Эти полезные или «хорошие» бактерии играют ключевую роль в защите от инфекции. Лактобациллы обеспечивают защиту от микробов из внешней среды, а также от микробов, которые обитают во влагалище, но ненормально быстро размножаются, вызывая, например, молочницу или вагиноз.

    Lactobacilli защищают от вагинальной инфекции, просто заселяя доступное пространство. Они также производят молочную кислоту и перекись водорода. Молочная кислота помогает поддерживать здоровый pH и флору влагалища. Перекись водорода подавляет рост «плохих» бактерий, вызывающих инфекцию. Когда уровень лактобацилл нарушается и микрофлора влагалища становится несбалансированной, увеличивается риск развития инфекции. Инфекции могут вызывать неприятные симптомы, такие как зуд, раздражение, жжение, аномальные выделения и неприятный запах из влагалища.

    Баланс между полезными и вредными бактериями во влагалище очень хрупкий, и дисбаланс возникает, если рН влагалища недостаточно кислый. PH влагалища должен быть где-то между 3,8 и 4,5 для нормального уровня кислотности влагалища. Если влагалище недостаточно кислое из-за нехватки лактобацилл, тогда грибы и «плохие» бактерии могут воспроизводить больше, чем обычно. Двумя примерами инфекции, возникающей таким образом, являются молочница (вызванная чрезмерным ростом грибка Candida) и бактериальный вагиноз (вызванный чрезмерным ростом «плохих» бактерий).

    Факторы риска

    Физиологические или внешние факторы, которые могут увеличить риск дисбаланса влагалищной флоры и, следовательно, инфекции, включают следующее:

    • Антибиотики
    • Курение
    • Неправильное или чрезмерное промывание паховой области
    • Гормональные изменения в результате беременности, использования противозачаточных средств или менопаузы
    • Незащищенный секс
    • Напряжение
    • Сауна или бассейн
    • Синтетическая или обтягивающая одежда или нижнее белье
    • Кондиционер для белья
    • Вагинальный душ
    • Внутриматочная спираль

    Пробиотики

    Пробиотики, бактерии, встречающиеся в организме в естественных условиях, часто рекомендуются для лечения дисбаланса влагалищной флоры.Пробиотики помогают восстановить здоровый уровень лактобацилл. Поддерживая здоровый баланс вагинальной флоры, восстанавливается защита организма от инфекций.

    Флора влагалища и беременность

    В исследовании 2012 года, проведенном Kjersti Aagaard и его коллегами, опубликованном в PloS One , изучалось, изменяется ли флора влагалища во время беременности. Они сравнили 68 образцов от 24 беременных женщин с 310 образцами от 60 небеременных контрольных женщин. Секвенирование ДНК показало, что, как правило, в образцах, взятых у беременных женщин, было гораздо меньше бактериального разнообразия и меньше бактериальных колоний, особенно в областях влагалища, которые были близко к матке.

    Источники
    1. Как бактерии во влагалище меняются во время беременности, blogs.scientificamerican.com/…/
    2. NHS, Бактериальный вагиноз, www.nhs.uk/conditions/bacterialvaginosis/Pages/Introduction.aspx

    Дополнительная литература

    Роль видов Lactobacillus во флоре промежуточного влагалища на ранних сроках беременности: ретроспективное когортное исследование

    Абстрактные

    Фон

    Плохие акушерские исходы связаны с дисбалансом влагалищной флоры.В настоящем исследовании оценивалась роль вагинальных видов Lactobacillus у женщин с промежуточной флорой влагалища в отношении акушерских исходов.

    Методы

    Мы ретроспективно проанализировали данные всех женщин с одноплодной беременностью, которые проходили плановый скрининг на бессимптомные вагинальные инфекции в нашем специализированном специализированном центре в период с 2005 по 2014 год. Влагалищные мазки окрашивали по Граму и классифицировали в соответствии с системой оценки Nugent как нормальную флору (оценка 0 –3), промежуточная микрофлора влагалища (4–6) или бактериальный вагиноз (7–10).Обследовались только женщины со средней микрофлорой влагалища. Женщины с оценкой Nugent 4 были разделены на женщин с лактобациллами и без них. Контрольные мазки были получены через 4–6 недель после первоначальных мазков. Был проведен описательный анализ данных, тест Велча t , точный тест Фишера и множественный регрессионный анализ с поправкой на искажающие факторы. Критериями оценки были гестационный возраст при родах и вес при рождении.

    Результаты

    При антенатальном скрининге у 529/8421 женщин была выявлена ​​промежуточная микрофлора влагалища.Среди них 349/529 (66%) имели оценку Nugent 4, 94/529 (17,8%) оценку Nugent 5 и 86/529 (16,2%) оценку Nugent 6. Среди тех, кто получил оценку Nugent. из 4 232/349 (66,5%) женщин были в группе Lactobacilli и 117/349 (33,5%) в группе Non-Lactobacilli. Частота преждевременных родов была значительно ниже в группе Lactobacilli, чем в группе Non-Lactobacilli (OR 0,34, CI 0,21–0,55; p <0,001). Средняя масса тела при рождении в исследуемых группах составила 2979 ± 842 г и 2388 ± 1155 г соответственно (MD 564.12, CI 346,23–781,92; p <0,001). При контрольных мазках частота бактериального вагиноза составила 9% в группе Lactobacilli и 7,8% в группе Non-Lactobacilli.

    Выводы

    Отсутствие вагинальных видов Lactobacillus и любой бактериальной колонизации увеличивает риск преждевременных родов и низкой массы тела при рождении у женщин с промежуточной флорой влагалища на ранних сроках беременности.

    Образец цитирования: Farr A, Kiss H, Hagmann M, Machal S, Holzer I., Kueronya V, et al.(2015) Роль видов Lactobacillus в промежуточной флоре влагалища на ранних сроках беременности: ретроспективное когортное исследование. PLoS ONE 10 (12): e0144181. https://doi.org/10.1371/journal.pone.0144181

    Редактор: Шерил С. Розенфельд, Университет Миссури, США

    Поступила: 3 августа 2015 г .; Принята к печати: 13 ноября 2015 г .; Опубликован: 11 декабря 2015 г.

    Авторские права: © 2015 Farr et al.Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника

    Доступность данных: Все соответствующие данные находятся в пределах документ и вспомогательные информационные файлы к нему.

    Финансирование: У авторов нет поддержки или финансирования, чтобы сообщить.

    Конкурирующие интересы: Авторы заявили, что конкурирующих интересов не существует..

    Сокращения: BV, бактериальный вагиноз; CI, доверительный интервал; Lactobacillus spp., Lactobacillus видов; Доктор медицины, средняя разница; ИЛИ ЖЕ, отношение шансов; PTD, преждевременные роды; SD, стандартное отклонение

    Введение

    Несмотря на недавние достижения в перинатальной помощи, профилактика преждевременных родов (ПП) остается серьезной проблемой в современном акушерстве [1].Здоровая флора влагалища, в которой преобладают вида Lactobacillus (spp.), Играет важную роль в защите от инфекций половых органов, которые считаются частой причиной PTD [2]. Дисбаланс вагинальной флоры, вызванный уменьшением доли Lactobacillus spp. может привести к чрезмерному росту смешанных анаэробных бактерий, что в конечном итоге может привести к бактериальному вагинозу (БВ) [3]. С тех пор, как был введен эффект лечения беременных женщин с аномальной микрофлорой влагалища, БВ вызвал интерес и в настоящее время является хорошо известным фактором риска восходящих инфекций и последующей ПЗ [4].Тем не менее, общее снижение риска PTD за счет лечения антибиотиками патологической флоры было опровергнуто крупными и хорошо спланированными исследованиями в общей акушерской популяции [5,6].

    В настоящее время мало что известно о роли промежуточной микрофлоры влагалища, которую можно рассматривать как переход от здоровой к патологической флоре или как переход от патологической флоры обратно к здоровой микробиоте влагалища [7]. Промежуточная вагинальная флора составляет весьма гетерогенную группу, которая может включать или не включать вагинальные Lactobacillus spp.и это может характеризоваться или не характеризоваться присутствием анаэробных бактерий [8,9]. В 2007 году метаанализ показал, что наличие промежуточной микрофлоры влагалища не было связано с PTD, поздним выкидышем, материнской или неонатальной инфекцией или перинатальной смертностью [10]. Напротив, в наблюдательном исследовании Hay et al. [11] сообщили о высоком уровне поздних выкидышей (16–24 недели гестации) у женщин с промежуточной флорой влагалища при обследовании до 16 недель гестации. Кроме того, в другом исследовании сообщалось о связи PTD с частичным BV, который определяется как полосы флоры BV в мазке, который имеет участки нормальной флоры [12].

    Учитывая, что связь между промежуточной флорой влагалища и PTD неясна, настоящее исследование направлено на оценку роли вагинальных Lactobacillus spp. у женщин с промежуточной вагинальной флорой по шкале Nugent на ранних сроках беременности.

    Материалы и методы

    Заявление о соблюдении этических норм

    Исследование было проведено с одобрения этического комитета Венского медицинского университета (поправка к протоколу № 1101/2014) в соответствии с Хельсинкской декларацией и руководящими принципами надлежащей клинической практики при поддержке руководителя института.В связи с ретроспективным характером исследования письменное информированное согласие получено не было. Карты и данные пациентов были обезличены и обезличены перед анализом.

    Настройка и порядок действий

    В этом исследовании ретроспективно проанализированы данные всех женщин, которые поступили с одноплодной беременностью в Венский медицинский университет, отделение акушерства и гинекологии, в период с 1 января 2005 года по 31 декабря 2014 года. Наш центр является крупнейшим специализированным специализированным центром в Австрии и специализируется на оказании помощи при беременности с высоким риском.Центр выполняет около 3000 доставок в год и получает рекомендации со всей Центральной и Восточной Европы.

    Уход за беременными включал в себя дородовую консультацию, когда женщины записывались в наше отделение для запланированных родов на сроках от 10 + 0 (10 недель плюс 0 дней) до 16 + 0 (16 недель плюс 0 дней) недель беременности. Женщины прошли плановое обследование на бессимптомные вагинальные инфекции. Кроме того, измеряли прозрачность затылочной кости плода, а также собирали медицинский и акушерский анамнез [13].Всех женщин, за исключением женщин с нормальной флорой (оценка по шкале Ньюджента 0–3), попросили пройти контрольный мазок на сроках от 14 + 0 (14 недель плюс 0 дней) до 22 + 0 (22 недели плюс 0 дней) гестационных недель в нашей клинике. отделение. Дальнейшие консультации были обязательными и проводились в заранее определенные моменты времени в акушерских кабинетах в соответствии с официальной австрийской программой социального обеспечения, которая обеспечивает меры предосторожности для здоровья беременных женщин и их плодов [14].

    Влагалищные мазки были получены после сбора вагинальной жидкости стерильными мазками с боковой стенки влагалища и заднего свода влагалища.Все мазки были окрашены по Граму и подвергнуты микроскопическому анализу одним из четырех биомедицинских лаборантов, специализирующихся в гинекологической цитопатологии, в лаборатории, сертифицированной в соответствии с DIN EN ISO 9001: 2008. (Регулярные тренинги по управлению качеством обязательны для всех лаборантов, которые вместе анализируют более 5300 мазков, окрашенных по Граму в год). Протокол включал классификацию вагинальной флоры, как описано Nugent et al. [9]. Баллы по шкале Nugent 0–3 считались показателями нормальной микрофлоры влагалища, 4–6 — промежуточной микрофлорой влагалища и 7–10 — BV.Согласно системе оценки Nugent, оценка Nugent 4 включала вагинальную флору с Lactobacillus spp и без нее. Присутствие или отсутствие Candida albicans и Trichomonas vaginalis оценивали с помощью теста на микробную идентификацию с использованием технологии ДНК-зонда (BD Affirm VP III; Becton Dickinson Co., Sparks, MD, США).

    Согласно нашему клиническому протоколу, женщины с нормальной или средней вагинальной флорой не получали лечения.Лечение BV включало клиндамицин 2% вагинальный крем в течение 6 дней в случае первичной инфекции, пероральный клиндамицин (0,3 г) дважды в день в течение 7 дней в случае рецидива инфекции BV, местный клотримазол (0,1 г) в течение 6 дней в случаях вагинальный кандидоз и местный метронидазол (0,5 г) в течение 7 дней в случае трихомониаза [15]. После лечения антибиотиками вводили вагинально Lactobacillus spp. в течение 6 дней для восстановления физиологической флоры [16].

    Учебные комиссии

    Исследуемая популяция включала женщин, которые были записаны на плановые роды, прошли плановый скрининг на инфекции и имели промежуточную микрофлору влагалища.Среди обследованных женщин были женщины с хроническими заболеваниями, а также с сопутствующими заболеваниями и плохим акушерским анамнезом. Тем не менее, только женщины без признаков вагинальной инфекции (без заметного покраснения, выделений или вагинального зуда) были допущены к исследованию. Действительно, женщины с нормальной микрофлорой влагалища (оценка по шкале Ньюджента 0–3), а также женщины с BV (оценка по шкале Ньюджента 7–10), трихомониазом и / или кандидозом по результатам первоначальных скрининговых мазков не могли быть включены в исследование. Кроме того, женщины, которые были направлены в дородовой период из других больниц в связи с неизбежной PTD, и те, кто не прошел программу дородового скрининга, не были включены в исследуемую популяцию.

    У женщин с оценкой Nugent 4 мы различали женщин с вагинальными Lactobacillus spp. И без них, а именно. группы Lactobacilli и группы Non-Lactobacilli. Группа Lactobacilli была определена как группа с промежуточной вагинальной флорой (оценка Nugent 4) с колонизацией бактериями, включая вагинальные Lactobacillus spp. Группа Non-Lactobacilli была определена как группа с промежуточной вагинальной флорой (оценка Nugent 4) без какой-либо бактериальной колонизации или Lactobacillus spp., показывая только эпителиальные клетки на исследуемых мазках. Мы не оценивали роль Lactobacillus spp. у женщин с 5 и 6 баллами по Ньюдженту, поскольку чрезмерный рост смешанных анаэробных бактерий мог повлиять на наши результаты в этих группах [9]. Мы также считали, что эффекты, связанные с BV, могут быть слабее у женщин с оценкой Nugent 4, чем у женщин с оценкой Nugent 5 и 6 [17].

    Показатели результата

    Гестационный возраст на момент родов считался первичной переменной исхода и регистрировался как срочные роды на сроке 37 + 0 (37 недель плюс 0 дней) гестационных недель или позже.PTD был определен как спонтанные роды на сроке 36 + 6 (36 недель плюс 6 дней) гестационных недель или ранее из-за преждевременного преждевременного разрыва плодных оболочек и / или преждевременных родов. Вторичными переменными результата были PTD и низкая масса тела при рождении, определяемая как масса тела менее 2500 г. Мертворождение было определено как срок или PTD младенца, умершего в утробе матери (оценка по шкале Апгар 0/0/0). Данные были извлечены из акушерских баз данных, карт пациентов и микробиологических отчетов.

    Статистический анализ

    Демографическая информация была обобщена и отображена с использованием описательной статистики.Непрерывные данные представлены как среднее значение ± стандартное отклонение (SD), если не указано иное. Дискретные данные представлены в виде числа (процентов). Тест Велча t использовался для сравнения непрерывных данных, а точный тест Фишера использовался для сравнения категориальных данных. Логистическая или линейная регрессия использовалась для определения скорректированных эффектов переменных. Модель множественной регрессии включала смешивающие переменные, которые были неравномерно распределены между группами, сравнивались и считались влияющими на конечную точку.Решение внести поправку на потенциальный конфаундер было основано на тесте Уэлча t для непрерывных переменных и точном тесте Фишера для дихотомических переменных. Все статистические анализы были выполнены с использованием R-Project для статистических вычислений, версия 3.1.3 (http://www.r-project.org; R Development Core Team, Бостон, Массачусетс) и SPSS Statistics, версия 23.0 (IBM, Armonk, Нью-Йорк). Карты пациентов были просмотрены в электронном виде с использованием базы данных PIA Fetal Database, версия 5.6.16.917 (GE Viewpoint, Мюнхен, Германия).Двустороннее значение p <0,05 считалось показателем статистической значимости во всех тестах.

    Результаты

    В общей сложности 8421 бессимптомная женщина с одноплодной беременностью поступила на плановый дородовой скрининг в наш специализированный специализированный центр в период с 2005 по 2014 год. Промежуточная микрофлора влагалища была выявлена ​​в скрининговых мазках 529/8421 (6,3%) женщин. В этой группе 349/529 (66%) женщин имели оценку Nugent 4, 94/529 (17,8%) имели оценку Nugent 5 и 86/529 (16.2%) имели оценку Nugent, равную 6. У женщин с оценкой Nugent 4, 232/349 (66,5%) женщин были отнесены к группе Lactobacilli. Группа Non-Lactobacilli состояла из 117/349 (33,5%) женщин с оценкой Nugent 4 из-за полного отсутствия какой-либо бактериальной колонизации, включая Lactobacillus spp. Согласно нашему стандартному протоколу, женщины ни в одной из исследуемых групп не получали никакого лечения от микробиоты влагалища. Исходные параметры 529 участников исследования с промежуточной вагинальной флорой, согласно шкале Ньюджента, представлены в таблице 1.

    Когорта женщин с промежуточной флорой влагалища на антенатальном скрининге родила в среднем 36,6 ± 4,9 недели беременности, что соответствует частоте ПЗР 30,4%. Среди женщин с оценкой Nugent 4, у женщин с оценкой 5 и у женщин с оценкой 6 частота PTD составила 32,7%, 27,7% и 24,4% соответственно. Подробные акушерские исходы для всех женщин с промежуточной вагинальной флорой представлены в таблице 2. В группе с оценкой по шкале Ньюджента 4 женщины из группы Lactobacilli имели средний гестационный возраст на момент родов 37.5 ± 4,9 недель по сравнению с 34,3 ± 5,8 неделями в группе нелактобацилл (средняя разница [MD] 3,18, доверительный интервал [CI] 1,99–4,36; p <0,001). Частота PTD в этих группах составила 24,1% и 49,6% соответственно (отношение шансов [OR] 0,33, CI 0,19–0,53; p <0,001).

    Подробные акушерские исходы у 349 женщин с промежуточной флорой влагалища и 4 баллами по шкале Ньюджента представлены в таблице 3. Средняя масса тела при рождении в исследуемой популяции с промежуточной флорой влагалища составляла 2813 ± 971 г.Младенцы из группы Lactobacilli имели средний вес при рождении 2979 ± 842 г по сравнению с 2388 ± 1155 г в группе Non-Lactobacilli (MD 591,66, CI 352,68–830,64; p <0,001). Женщины в группе Lactobacilli реже рожали детей с массой тела при рождении менее 2500 г, чем в группе Non-Lactobacilli (20,7% против 42,8%; OR 0,35, CI 0,21–0,58; p <0,001; Рис. 1 ).

    Для определения факторов, которые должны быть включены в качестве потенциальных факторов, влияющих на модель множественной регрессии, включая возраст матери, родство, высшее образование, курение табака и наличие PTD в анамнезе, были выполнены точный тест Фишера и t -тест Велча. .Четность была единственным значимым фактором риска PTD при сравнении групп Lactobacilli и Non-Lactobacilli (OR 2,27, CI 1,41–3,67; p <0,001). Кроме того, паритет был значимым фактором риска развития PTD при сравнении общей группы женщин с промежуточной вагинальной флорой и группой, не получавшей Lactobacilli (OR 2,45, CI 1,58–3,81; p <0,001). После поправки на паритет отсутствие Lactobacillus spp. и другие бактерии оказали значительное влияние на срок беременности при родах (MD 3.09, CI 2.03–4.16; p <0,001) и вес при рождении (MD 564,12, CI 346,23–781,92; p <0,001) у 529 женщин с промежуточной флорой влагалища (таблица 4).

    Мазки для последующего наблюдения были доступны для 220/349 (63%) женщин, имевших начальный балл по Ньюдженту 4, а остальные женщины были потеряны для последующего наблюдения. Эти женщины включали 156/232 (67,2%) в группу Lactobacilli и 64/117 (54,7%) в группу Non-Lactobacilli. Как показано на рис. 2, у 89 из 156 (57%) женщин из группы Lactobacilli развилась нормальная микрофлора влагалища, тогда как у 14 из 156 (9%) женщин развился БВ.В группе лиц, не принимавших Lactobacilli, нормальная флора и BV были обнаружены в мазках после контрольного обследования 46/64 (71,9%) и 5/64 (7,8%) женщин, соответственно.

    Обсуждение

    Настоящее исследование направлено на оценку роли вагинальных Lactobacillus spp. у женщин с промежуточной флорой влагалища, поскольку в литературе имеется очень мало информации по этому поводу [8]. В дискуссиях об эффективности программ дородового скрининга аномальной микрофлоры влагалища исследования в основном относятся к БВ как к опасному состоянию, которое вызывает восходящую инфекцию из-за дисбаланса во влагалищной флоре, повышая риск спонтанного ПТД у пораженных женщин [6,13, 18].Кроме того, в исследованиях сообщается, что промежуточная вагинальная флора может играть роль в инфекционной этиологии PTD не только за счет перехода к BV, но и за счет снижения доли Lactobacillus spp. [19,20]. В нашем исследовании среди женщин с промежуточной вагинальной флорой и 4 баллами по шкале Ньюджента мы сравнивали женщин с вагинальными Lactobacillus spp и без них. и наблюдали связь между отсутствием вагинальных Lactobacillus spp., PTD и низкий вес при рождении.

    В наше исследование включение женщин с промежуточной вагинальной флорой было основано на балльной системе Nugent et al. [9], который оценивает долю морфотипов бактерий под микроскопом. Мы обнаружили уровень 6,3% (529/8421) с промежуточной вагинальной флорой и оценкой по шкале Ньюджента 4–6, что меньше, чем частота 10–21%, о которой сообщалось в других исследованиях, в которых оценивали флору влагалища у бессимптомных женщин во время первого. триместр беременности [12,20,21].Это различие может быть связано с тем, что социально-экономический статус большинства женщин в нашем исследовании был выше, чем в предыдущем. Более того, женщины могли пройти лечение до зачатия по поводу патологической флоры. Большинство пациенток с промежуточной вагинальной флорой в нашем исследовании имели оценку Nugent 4 (66%).

    Несмотря на результаты крупного проспективного исследования, в котором сообщалось о PTD у женщин с дефицитом Lactobacillus spp. на сроке от 25 до 35 недель гестации данные, касающиеся балльной системы Nugent, отсутствуют [12].Насколько нам известно, наше исследование является первым, в котором оценивается система оценки Nugent у женщин с промежуточной вагинальной флорой и демонстрируется более низкая частота PTD у женщин с оценкой Nugent 5 и 6, чем у женщин с оценкой Nugent 4. Рис. 1 и как указано в Таблице 2, мы обнаружили, что у женщин с оценкой Nugent 6 был увеличен гестационный возраст на момент родов и масса тела при рождении по сравнению с общей группой или женщинами с оценкой Nugent 4. распространенность PTD среди женщин с высокими показателями Nugent, которые имели тенденцию к BV, например, 6 баллов по шкале Nugent.В отсутствие поправок на возможные факторы, влияющие на факторы, обратная тенденция могла быть вызвана присутствием Lactobacillus spp. у женщин с промежуточной вагинальной флорой и оценками по шкале Nugent 5 и 6. К сожалению, мы не смогли исследовать это дальше, так как у этих женщин не была доступна подробная информация о вагинальной микробиоте. Кроме того, следует учитывать ассоциацию Lactobacillus iners и Lactobacillus gasseri с промежуточной флорой влагалища и БВ, а также отрицательное влияние Lactobacillus iners на PTD у беременных [22,23].

    При сравнении групп, принимавших Lactobacilli и Non-Lactobacilli, мы наблюдали значительные различия в отношении PTD и средней массы тела при рождении, хотя в группах был одинаковый показатель Nugent, равный 4. Наибольшие различия были обнаружены для женщин, родивших между 23 + 0 и 31 + 6. гестационные недели и для детей, чей вес при рождении составлял от 500 до 1499 г. Это было подтверждено в модели множественной регрессии после поправки на паритет в качестве единственного существенного искажающего фактора (таблица 4). Вероятность родов раньше 37 + 0 недель гестации и веса при рождении менее 2500 г была выше в группе, не получавшей Lactobacilli, чем в группе Lactobacilli.Следовательно, женщины с промежуточной вагинальной флорой и 4 баллами по шкале Nugent имели высокий риск развития ПЗ и родов с низкой массой тела при рождении при вагинальном введении Lactobacillus spp. отсутствовали. С клинической точки зрения, это открытие может способствовать лечению Lactobacillus spp. у бессимптомных женщин с оценкой Nugent 4 и полным отсутствием бактериальной колонизации. Более того, обнаружение того факта, что женщины с промежуточной микрофлорой влагалища, помимо женщин с БВ, подвержены риску развития ПЗП, поддерживает реализацию плановых программ дородового скрининга для выявления аномальной флоры и начала лечения, что поможет улучшить акушерские исходы [13,24] .

    Мы попытались выявить сдвиг в сторону БВ на более поздних сроках беременности, оценивая мазки вагинального последующего наблюдения, поскольку этот сдвиг может быть ответственным за высокий риск развития ПТЗ в группе нелактобацилл. Однако после оценки имеющихся мазков последующего наблюдения мы обнаружили, что скорость развития BV была сходной в группах Lactobacilli и Non-Lactobacilli (9% против 7,8%, рис. 2). Мы предположили, что высокий уровень нормальной флоры в группе нелактобациллов мог быть достигнут за счет улучшенной колонизации вагинальными Lactobacillus spp.при полном отсутствии бактерий. Однако колонизация может быть затруднена, если присутствуют палочки, отличные от Lactobacilli, и это объясняет низкие показатели нормальной флоры в контрольных мазках группы Lactobacilli. В 2014 году Honda et al. [20] наблюдали сдвиг микрофлоры влагалища от нормального к промежуточному при обычном скрининге на инфекции во втором триместре у женщин, у которых позже возникла ПЗ. Авторы предположили, что PTD был связан с промежуточной флорой, а не с BV, и что этот сдвиг может быть причиной неудач в предотвращении PTD, о которых сообщалось в нескольких исследованиях [20].Мы не считаем, что переход в сторону БВ может объяснить наши выводы, хотя следует принимать во внимание ограниченную доступность мазков для последующего наблюдения в нашем исследовании и общее небольшое количество женщин, прошедших последующее наблюдение.

    Насколько нам известно, это первая статья, в которой оценивается роль Lactobacillus spp. в промежуточной микрофлоре влагалища, кроме БВ [11,12,15]. Хотя наше исследование является одним из крупнейших исследований по оценке роли Lactobacillus spp., наши результаты следует интерпретировать с осторожностью, учитывая ретроспективный дизайн исследования. Возможно, что на частоту возникновения ПЗ в группе нелактобациллов повлияли другие факторы, помимо инфекции, которая произошла на более поздних сроках беременности. Хотя вагинальная инфекция является основным причинным фактором PTD, следует учитывать такие основные факторы, как диабет, гипертония и ожирение [18]. Принимая во внимание высокую частоту ПЗ (32,7%) среди женщин с 4 баллами по шкале Ньюджента, следует также учитывать, что наше исследование проводилось в акушерских условиях с высоким риском.Ранее мы опубликовали, что общая частота PTD среди нашей бессимптомной популяции, включая женщин с промежуточной вагинальной флорой, составила 9,7% [13]. Анализ роли Lactobacillus spp. у женщин с оценкой Nugent 5 и 6, а также анализ в соответствии с различными подтипами вагинальных лактобактерий, должен быть выполнен в будущих исследованиях. Более того, при интерпретации наших результатов следует также учитывать более полные системы оценки, такие как система Ison и Hay [25].

    Заключение

    Настоящее исследование продемонстрировало связь между промежуточной флорой влагалища и многофакторным механизмом PTD. В частности, женщины с оценкой Nugent 4 и отсутствием какой-либо бактериальной колонизации, включая колонизацию Lactobacillus spp., Показали повышенный риск PTD и низкой массы тела при рождении при множественном регрессионном анализе. Эти данные показывают, что вагинальные Lactobacillus spp. играют важную роль в промежуточной микрофлоре влагалища и что их отсутствие может быть связано с патологическим состоянием.В частности, среди женщин с промежуточной вагинальной флорой и оценкой Nugent 4, женщины без Lactobacillus spp. следует отличать от таковых с Lactobacillus spp. Необходимы дальнейшие проспективные исследования, чтобы определить, нужна ли в этом отношении переоценка балльной системы Ньюджента.

    Благодарности

    Авторы благодарят Lisa Cichocki и Editage Services за их редакторскую помощь.

    Вклад авторов

    Задумал и спроектировал эксперименты: AF LP.Проведены эксперименты: AF HK LP SM IH VK. Проанализированы данные: MH AF. Предоставленные реагенты / материалы / инструменты анализа: SM LP. Написал статью: AF LP HK IH VK. Оказана клиническая поддержка и совместно организовано исследование: PWH.

    Ссылки

    1. 1. Браун HK, Speechley KN, Macnab J, Natale R, Campbell MK. Заболеваемость новорожденных, связанная с поздними преждевременными и ранними родами: роль гестационного возраста и биологические детерминанты преждевременных родов. Int J Epidemiol. 2014; 43: 802–814.pmid: 24374829
    2. 2. Leitich H, Bodner-Adler B, Brunbauer M, Kaider A, Egarter C, Husslein P. Бактериальный вагиноз как фактор риска преждевременных родов: метаанализ. Am J Obstet Gynecol. 2003. 189: 139–147. pmid: 12861153
    3. 3. Spiegel CA. Бактериальный вагиноз. Clin Microbiol Rev.1991; 4: 485-502. pmid: 1747864
    4. 4. Донати Л., Ди Вико А., Нуччи М., Квальоцци Л., Спаньоло Т., Лабианка А. и др. Микробная флора влагалища и исход беременности.Arch Gynecol Obstet. 2010. 281: 589–600. pmid: 19967381
    5. 5. Ugwumadu A, Manyonda I., Reid F, Hay P. Влияние раннего перорального клиндамицина на поздний выкидыш и преждевременные роды у бессимптомных женщин с аномальной микрофлорой влагалища и бактериальным вагинозом: рандомизированное контролируемое исследование. Ланцет. 2003; 361: 983–988. pmid: 12660054
    6. 6. Броклхерст П., Гордон А., Хитли Е., Милан С.Дж. Антибиотики для лечения бактериального вагиноза при беременности. Кокрановская база данных Syst Rev.2013; 1: CD000262. pmid: 23440777
    7. 7. Donders GG. Определение и классификация аномальной микрофлоры влагалища. Лучшая практика Res Clin Obstet Gynaecol. 2007. 21: 355–373. pmid: 17434799
    8. 8. Хиллиер С.Л., Крон М.А., Ньюджент Р.П., Гиббс Р.С. Характеристики трех паттернов влагалищной флоры, оцененные с помощью окрашивания по Граму среди беременных женщин. Группа изучения вагинальных инфекций и недоношенности. Am J Obstet Gynecol. 1992; 166: 938–944. pmid: 1372474
    9. 9. Ньюджент Р.П., Крон М.А., Хиллиер С.Л.Надежность диагностики бактериального вагиноза повышается за счет стандартизированного метода интерпретации окраски по Граму. J Clin Microbiol. 1991; 29: 297–301. pmid: 1706728
    10. 10. Leitich H, Kiss H. Бессимптомный бактериальный вагиноз и промежуточная флора как факторы риска неблагоприятного исхода беременности. Лучшая практика Res Clin Obstet Gynaecol. 2007. 21: 375–390. pmid: 17241817
    11. 11. Hay PE, Lamont RF, Taylor-Robinson D, Morgan DJ, Ison C, Pearson J. Аномальная бактериальная колонизация половых путей и последующие преждевременные роды и поздний выкидыш.BMJ. 1994; 308: 295–298. pmid: 8124116
    12. 12. Дондерс Г.Г., Ван Калстерен К., Беллен Дж., Рейбрук Р., Ван ден Бош Т., Рифаген I и др. Прогностическое значение для преждевременных родов с аномальной микрофлорой влагалища, бактериальным вагинозом и аэробным вагинитом в течение первого триместра беременности. BJOG. 2009. 116: 1315–1324. pmid: 19538417
    13. 13. Фарр А., Кисс Х., Хагманн М., Маршалек Дж., Хасслейн П., Петричевич Л. Регулярное использование дородовой программы скрининга и лечения инфекций для предотвращения преждевременных родов: многолетний опыт работы в специализированном специализированном центре.Рождение. 2015; 42: 173–180. pmid: 25677078
    14. 14. Сперно Р., Рудельсторфер Р., Грубер В. [Влияние дородовой помощи в общей практике и в клинике на течение беременности и родов]. Wien Med Wochenschr. 1985. 135: 65–69. pmid: 3984353
    15. 15. Lamont RF, Nhan-Chang CL, Sobel JD, Workowski K, Conde-Agudelo A, Romero R. Лечение аномальной микрофлоры влагалища на ранних сроках беременности клиндамицином для предотвращения спонтанных преждевременных родов: систематический обзор и метаанализ.Am J Obstet Gynecol. 2011; 205: 177–190. pmid: 22071048
    16. 16. Парма М., Стелла Ванни В., Бертини М., Кандиани М. Пробиотики в профилактике рецидивов бактериального вагиноза. Altern Ther Health Med. 2014; 20 Дополнение 1: 52–57. pmid: 24473986
    17. 17. Leitich H, Brunbauer M, Bodner-Adler B, Kaider A, Egarter C, Husslein P. Антибиотикотерапия бактериального вагиноза во время беременности: метаанализ. Am J Obstet Gynecol. 2003. 188: 752–758. pmid: 12634652
    18. 18.Гольденберг Р.Л., Калхейн Дж. Ф., Ямс Дж. Д., Ромеро Р. Эпидемиология и причины преждевременных родов. Ланцет. 2008. 371: 75–84. pmid: 18177778
    19. 19. Хиллер С.Л., Ньюджент Р.П., Эшенбах Д.А., Крон М.А., Гиббс Р.С., Мартин Д.Х. и др. Связь между бактериальным вагинозом и преждевременными родами ребенка с низкой массой тела при рождении. Группа изучения вагинальных инфекций и недоношенности. N Engl J Med. 1995; 333: 1737–1742. pmid: 74
    20. 20. Honda H, Yokoyama T, Akimoto Y, Tanimoto H, Teramoto M, Teramoto H.Частый переход к промежуточной флоре в случаях преждевременных родов после выявления аномальной микрофлоры влагалища. Sci Rep.2014; 4: 4799. pmid: 24762852
    21. 21. Герра Б., Гхи Т., Кварта С., Морселли-Лабате А.М., Лаццаротто Т., Пилу Г. и др. Исход беременности после раннего выявления бактериального вагиноза. Eur J Obstet Gynecol Reprod Biol. 2006; 128: 40–45. pmid: 16460868
    22. 22. Равель Дж., Гайер П., Абдо З., Шнайдер Г.М., Кениг С.С., МакКулл С.Л. и др. Микробиом влагалища женщин репродуктивного возраста.Proc Natl Acad Sci U S. A. 2011; 108 Приложение 1: 4680–4687. pmid: 20534435
    23. 23. Petricevic L, Domig KJ, Nierscher FJ, Sandhofer MJ, Fidesser M, Krondorfer I, et al. Характеристика вагинальной микробиоты Lactobacillus, связанной с преждевременными родами. Sci Rep.2014; 4: 5136. pmid: 24875844
    24. 24. Kiss H, Petricevic L, Husslein P. Проспективное рандомизированное контролируемое исследование программы скрининга на инфекции для снижения частоты преждевременных родов. BMJ. 2004; 329: 371.pmid: 15294856
    25. 25. Ison CA, Hay PE. Валидация упрощенной классификации вагинальных мазков, окрашенных по Граму, для использования в клиниках мочеполовой медицины. Половая трансмиссия. 2002; 78: 413–415. pmid: 12473800

    Изменения микрофлоры влагалища, связанные с Mycoplasma hominis

    Abstract

    ЦЕЛЬ: Целью данного исследования было изучить любую связь между вагинальным носительством Mycoplasma hominis и генитальными признаками и симптомами, другими микробными находками и некоторыми факторами риска. у женщин с бактериальным вагинозом и без него. ДИЗАЙН ИССЛЕДОВАНИЯ: Женщины, посетившие две клиники планирования семьи и молодежную клинику для получения рекомендаций по контрацепции, были разделены в зависимости от результата вагинального посева на Mycoplasma hominis и наличия бактериального вагиноза. В исследуемую популяцию вошли 123 (12,3%) женщины, являвшиеся носителями Mycoplasma hominis . Те 873 (87,7%) с отрицательной культурой для Mycoplasma hominis служили группой сравнения. В первой группе у 50 (40,7%) был бактериальный вагиноз, как и у 81 (9.3%) женщин из группы сравнения. Группы сравнивали по признакам и симптомам гениталий, результатам микроскопии влагалищного мокрого мазка и других анализов в офисе, изменений влагалищной флоры, выявленных посевом, и других средств и выявления заболеваний, передающихся половым путем. Регистрировались любые заболевания, передающиеся половым путем, и другие генитальные инфекции, репродуктивный анамнез, использование оральных контрацептивов и курение. РЕЗУЛЬТАТЫ: Женщины-носители Mycoplasma hominis значительно чаще жаловались на рыбный запах, имели положительный аминный тест, pH влагалища> 4.7, и клетки-подсказки, чем в группе сравнения; все эти утверждения были верны до и после исключения бактериального вагиноза. Выделения из влагалища не предъявлялись значительно чаще, и патологические выделения не чаще выявлялись у носителей Mycoplasma hominis . Ureaplasma urealyticum встречалась у 75% из Mycoplasma hominis – положительных женщин и у 59% группы сравнения ( p = 0,001). Соотношение лейкоцитов / эпителиальных клеток существенно не отличалось от такового в отрицательном контроле культуры Mycoplasma hominis . ВЫВОД: Исследование предполагает, что Mycoplasma hominis ассоциируется с рядом генитальных признаков и симптомов даже после исключения бактериального вагиноза. (Am J Obstet Gynecol 1997; 176: 173-8.)

    Ключевые слова

    Mycoplasma hominis

    Изменение флоры влагалища

    генитальные симптомы и признаки

    Рекомендуемые статьи Цитирующие статьи (0)

    Просмотреть полный текст

    Copyright © 1997 Mosby, Inc. Все права защищены.

    Рекомендуемые статьи

    Ссылки на статьи

    Распространенные инфекционные заболевания | Государственная лаборатория гигиены штата Висконсин

    • Actinomyces
    • Кандидоз
    • Гарднерелла
    • Вирус простого герпеса
    • Трихомониаз

    Актиномицеты

    Actinomyces — это грамположительные анаэробные палочковидные бактерии.Наиболее частым предрасполагающим фактором является продолжительность использования ВМС. Тип ВМС не влияет на присутствие этой бактерии.

    У большинства женщин с положительной реакцией на инфекцию актиномицеты симптомы отсутствуют. Хотя эта бактерия обычно является комменсалом, есть сообщения о случаях актиномицетов, вызывающих воспалительные заболевания органов малого таза (ВЗОМТ) у женщин с ВМС.

    Актиномицеты выглядят как ватный диск или шерстяная нечеткая масса. Организмы представляют собой спутанные скопления палочек разной длины и имеют разветвленные под острым углом, не образующие спор бациллы.

    Обычно присутствует острая воспалительная реакция.

    Клинические признаки и симптомы:

    Кандидоз spp .

    Candida albicans вызывает 80-92% кандидозных инфекций. Кандида, или грибок, присутствует как часть нормальной микрофлоры влагалища у 15-20% здоровых женщин и до 30-40% беременных. Факторами, предрасполагающими женщин к кандидозу, являются: беременность, диабет, ВИЧ-инфекция, пероральные контрацептивы, использование антибиотиков или кортикостероидов, иммуносупрессия и рецидив кандиды в анамнезе.

    Другие факторы, которые могут увеличить частоту возникновения кандиды, включают использование спринцеваний, парфюмированных спреев для женской гигиены, местных антимикробных средств, а также тесной, плохо вентилируемой одежды и нижнего белья.

    Микроскопические исследования физиологического раствора и препаратов КОН выявляют почкующиеся дрожжевые клетки примерно в 50-70% случаев дрожжевых инфекций.

    Из экссудата делают мокрый мазок, в препарат добавляют 10-20% КОН.Грибки выглядят в виде длинных нитевидных волокон и могут иметь прикрепленные крошечные почки. Лактобациллы почти всегда отсутствуют в мазке с кандидозом.


    Клинические признаки и симптомы:

    • Густые белые творожные выделения без неприятного запаха
    • Вагинит
    • Пруит в области вульвы вместе с эритемой влагалища или вульвы
    • Выявление кандиды при отсутствии симптомов не должно приводить к лечению
    • pH менее 4.5
    • Влажная атмосфера

    Coccobaccillus (бактериальный вагиноз)

    Бактериальный вагиноз — заболевание, передающееся половым путем. Важно, чтобы лечились оба партнера. «Носители» — обычное дело. В отчетах цитологии это открытие указано как «сдвиг во влагалищной флоре, совместимый с coccobaccilli spp.»

    Лактобактерии отсутствуют; однако очевидны мелкие коккобациллы. Плоские клетки, которые покрыты слоем коккобацилл, особенно по краю клеточной мембраны, равномерно распределены и имеют зернистый вид, называются «ключевыми клетками».«Также на заднем плане видны скопления маленьких стержней.

    Клинические признаки и симптомы:

    Клинические критерии требуют наличия трех из четырех признаков / симптомов

    • Однородные белые / серые невоспалительные выделения, прилипающие к стенкам влагалища
    • Наличие ячеек подсказки на мокром монтаже
    • pH влагалища более 4,5
    • Рыбный запах до или после добавления КОН / теста на запах (КОН = гидроксид калия)

    Вирус простого герпеса

    Вирус простого герпеса (ВПГ) может сохранять латентное состояние на протяжении всей жизни хозяина.

    Клетки, инфицированные вирусом, обычно находятся на краю и в основании поражений. Когда герпес проявляется на слизистой оболочке половых губ, влагалища или обоих, инфекция проявляется в виде пузырьков. Поражение шейки матки и вульвы не редкость.

    И HSV1, и HSV2 имеют одинаковый цитологический отпечаток.

    Вирус вызывает проблемы с митозом, поскольку ядро ​​реплицируется, но клетка не делится должным образом. Это приводит к появлению многоядерных клеток. Хроматин ядра граничит с ядерной мембраной.Ядра также имеют тенденцию формироваться друг вокруг друга, чтобы поместиться в клеточной мембране.

    Клинические признаки и симптомы:

    Большинство инфекций, вызванных простым герпесом, протекает бессимптомно. Иммунный ответ хозяина, по-видимому, играет важную роль. Инкубационный период составляет 2-11 дней (обычно 6-7 дней). Инфицированные люди наиболее заразны в первые дни первичной инфекции, хотя вирус все еще может передаваться на поздних стадиях инфекции или от человека, не имеющего симптомов.

    Трихомониаз

    Трихомониаз передается половым путем. Лечение будет неполным, если не будут пролечены все партнеры. Трихомониаз — простейшее. По оценкам, каждый пятый человек заразится трихомониазом в течение своей жизни. Трихомониаз обычно передается при физическом контакте и недолго сохраняется вне организма.

    Клинические признаки и симптомы:

    • Часто выделения из влагалища имеют неприятный запах, обильные, пенистые, желто-серого или зеленого цвета
    • Вуловагинальное раздражение и зуд
    • Боль при половом акте

    Подобно кандидозным и коккобакциллярным инфекциям, трихамоны также можно увидеть с помощью влажного препарата.Клетки имеют овальную или округлую форму с грушевидным ядром. На влажных препаратах движение простейших по жгутикам легко идентифицировать.

    Инфекционный вагинит | GLOWM

    ВВЕДЕНИЕ

    Выделения из влагалища в основном состоят из воды с электролитами, микроорганизмами, эпителиальными клетками и органическими соединениями, такими как жирные кислоты, белки и углеводы. 19 Влагалищную жидкость в основном получают из транссудата сыворотки влагалищного ложа, который просачивается из капилляров через межклеточные каналы.Меньшее количество жидкости поступает из бартолиновых желез, шейки матки, эндометрия и маточных труб. Клеточные элементы представляют собой отшелушенные клетки столбчатого эпителия шейки матки и плоскоклеточного эпителия влагалища. Лейкоциты присутствуют только в небольшом количестве среди женщин без вагинита. 20

    Эстроген и pH — два важных фактора, которые влияют на типы бактерий, присутствующих во влагалищной флоре. Содержание молочной кислоты во влагалище обеспечивает кислый рН менее 4,5 у взрослых женщин.Молочная кислота вырабатывается метаболизмом Lactobacillus и вагинальными эпителиальными клетками путем распада гликогена. Низкий pH способствует росту ацидофильных организмов, таких как Lactobacillus , но подавляет рост большинства других бактерий. Lactobacillus занимает центральное место в ограничении роста других бактерий. 6 Lactobacillus также способны продуцировать H 2 O 2 , 21 , который подавляет рост бактерий, не содержащих каталазу.Комбинация галогенид-иона, такого как хлорид, в изобилии присутствующего во влагалище, с пероксидазой, присутствующей в эндометрии и влагалищной жидкости, 22 и H 2 O 2 , продуцируемых некоторыми штаммами Lactobacillus , образует мощную ингибирующую систему для некоторых бактерий во влагалище 23 и ВИЧ и других вирусов in vitro . 9

    Нормальные вагинальные микроорганизмы

    От 5 до 10 микроорганизмов могут быть извлечены из влагалища женщин, и основное внимание уделяется количеству извлеченных бактерий.Большинство исследований не контролировали наличие BV или «промежуточной» флоры на основе окрашивания по Граму, 24 , и, в зависимости от популяции, значительный и широкий круг людей страдает такими вагинальными состояниями. 25

    Таблица 1 описывает частоту и концентрацию микроорганизмов, выделенных при культивировании из влагалища беременных женщин, стратифицированных по критериям окраски по Граму. 24 Lactobacillus видов было выделено из 96% нормальной группы. 23 Исходя из средней log концентрации, Lactobacillus присутствовала в концентрации, в 10 раз превышающей на уровне log 10 7 , чем концентрация следующего микроорганизма, Gardnerella vaginalis , присутствующая при log 10 6 уровни примерно у половины пациентов. 23 Lactobacillus присутствовала в концентрации от 90 до 100 раз выше, чем у следующих по численности микроорганизмов, видов Enterococcus и Ureaplasma urealyticum .Для половины женщин без G. vaginalis , видов Lactobacillus составляли 98% или более от фактического количества микроорганизмов, а у женщин с G. vaginalis , Lactobacillus составляли около 90% от общего числа микроорганизмов. количество микроорганизмов во влагалище людей с нормальными результатами окрашивания по Граму и Lactobacillus — доминирующая флора. По этим результатам можно оценить полное доминирование видов Lactobacillus во влагалище женщин с нормальной флорой влагалища.В этой нормальной флоре только от 1% до 5% концентрации составляют потенциально патогенные аэробные бактерии и микоплазмы, такие как Staphylococcus aureus , стрептококки группы B, E. coli или некоторые из потенциально патогенных анаэробов.

    ТАБЛИЦА 1. Частота и логарифмическая концентрация выбранных микроорганизмов во влагалище, стратифицированных по образцу пятен по Граму

    9102 Нормальный

    03 03 46135 151134

    17

    (10 4.1 )

    Частота (логарифмическая концентрация)

    Промежуточный

    BV

    Микроорганизм

    (n = 39)

    P

    значение

    Всего Lactobacillu с

    96 (10 7.0 )

    85 (10 6,6 )

    67 (10 6,3 )

    <0,001

    H 2 O 9098obacillus 2 88

    61 (10 7,2 )

    40 (10 6,5 )

    5

    <0,001

    Gardnerella

    4

    Gardnerella 6.0 )

    79 (10 6,5 )

    92 (10 7,7 )

    <0,001

    Стрептококки группы B

    )

    17 (10 4,1 )

    21 (10 5,8 )

    0,2 ​​

    Escherichia coli

    1 )

    15 (10 3,0 )

    21 (10 4,6 )

    0,6

    Mycoplasma hominis 9113 901 )

    38 (10 4,8 )

    61 (10 5,2 )

    <0,001

    Ureaplasma urealyticum

    91 (10 5 )

    92 (10 5 )

    0.01

    Анаэробный грамотрицательный стержень

    91 (10 4,3 )

    89 (10 5,0 )

    100 (10 6,0 )

    901 901

    > 10 5 КОЕ / мл

    33

    45

    62

    0,002

    68 (10 4,6 )

    77 (10 5,5 )

    0,1

    > 10 5 КОЕ / мл

    21

    39

    0,005

    Bacteroides ureolyticus

    36 (10 3 )

    9040

    5 )

    59 (10 4,0 )

    0,01

    Mobiluncus sp.

    5

    13

    28

    0,004

    Fusobacterium nucleatum

    9192 Fusobacterium nucleatum

    900 2.9 )

    21 (10 3.8 )

    0,05

    Peptostreptococcus sp.

    91 (10 8,2 )

    91 (10 4,9 )

    90 (10 5,3 )

    0,7

    900 КОЕ / мл

    26

    47

    59

    0,002

    Candida albicans

    0.4


    КОЕ / мл, колониеобразующая единица на миллилитр вагинальной жидкости; БВ, бактериальный вагиноз.
    Данные Hillier SL, Krohn MA, Rabe LK et al. Нормальная микрофлора влагалища, H 2 O 2 -продуцирующая лактобациллы и бактериальный вагиноз у беременных. Clin Infect Dis 1993; 16 (Дополнение 4): S273.

    Распространенность Lactobacillus значительно снижается в случаях BV, в которых видов Lactobacillus больше не являются доминирующими микроорганизмами.В BV концентрация G . vaginalis (присутствует у 92% пациентов) обнаруживается при средней логарифмической концентрации 10 7,7 . 23 При BV снижается распространенность Lactobacillus , H 2 O 2 -положительных Lactobacillus практически исчезает, а концентрация анаэробных грамотрицательных палочек и видов Prevotella увеличивается. С BV Lactobacillus составляет 1% или менее от количества присутствующих бактерий (Таблица 1).

    Женщины в этом отчете с промежуточной флорой имели одинаковую распространенность и концентрацию Lactobacillus и G . vaginalis , а около 10% остальных микроорганизмов составили Enterococcus , U . urealyticum и анаэробные грамотрицательные палочки. 23 Ожидается, что хирургическая процедура, зараженная подавляющим большинством непатогенных Lactobacillus , вызовет значительно меньшую инфекцию, чем хирургическая процедура, в которой существуют более высокие концентрации патогенных бактерий.

    Механизмы вагинальной инфекции

    При изменении сложного баланса микроорганизмов потенциально патогенные эндогенные микроорганизмы, которые являются частью нормальной флоры, такие как Candida albicans в случае кандидоза и G. vaginalis и анаэробные бактерии в случаях BV, размножаются до концентрации, вызывающей симптомы. Мало что известно о факторах, способствующих разрастанию нормальной флоры. Патогенные экзогенные микроорганизмы, передающиеся половым путем, такие как Trichomonas vaginalis , N.gonorrhoeae и C. trachomatis также могут вызывать инфекцию.

    ДИАГНОСТИКА

    Диагностика вагинита не может основываться исключительно на наличии или отсутствии симптомов. У женщин с вагинитом встречается широкий спектр симптомов, который в значительной степени перекликается с симптомами, которые возникают у женщин без инфекции или вагинита. Для постановки диагноза вагинита врачи должны использовать физические и лабораторные параметры, а не симптомы. За исключением некоторых людей с типичными и четко выраженными симптомами кандидоза, самодиагностика еще более неточна. 3

    Диагноз вагинита в значительной степени основывается на микроскопических критериях. При обнаружении трихомонад, ключевых клеток или гиф специфичность составляет практически 100%. Однако чувствительность определения любого из этих трех микроскопических признаков с помощью влажного крепления составляет всего около 80% в идеальных условиях 26 и намного ниже при рецидивирующем кандидозе и у неопытных микроскопистов. Синдромальный диагноз и лечение неточны и неприемлемы ни в одном современном медицинском учреждении.Если диагноз не может быть установлен с уверенностью, через несколько дней следует провести отобранные культуры и повторное обследование, по крайней мере, женщинам с симптомами и подозрением на вагинит для постановки конкретного диагноза и женщинам с симптомами и предполагаемыми нормальными выделениями для дальнейшего исключения вагинита. Два обследования с нормальными результатами теоретически повышают диагностическую точность в обеих категориях до 96% (80% + [0,80 × 20%]). Использование повторного обследования снижает склонность врача исключать вагинит после одного «нормального обследования» у женщин с симптомами инфекции и может дать уверенность женщинам с симптомами инфекции с нормальными результатами обоих обследований об отсутствии инфекции.

    ФИЗИЧЕСКОЕ ОБСЛЕДОВАНИЕ

    Внешний вид вульвы

    Вульву следует обследовать на предмет географической эритемы или трещин, которые могут возникнуть при кандидозе и контактном дерматите, на наличие белого эпителия склероза лишайников, гипертрофического эпителия при нейродермите (909 и других поражениях). например, бородавок, кист, рака). Тонкие выделения из влагалища часто присутствуют во входе в рот у женщин с трихомониазом или БВ. Пациентов с чрезмерной болезненностью вульвы следует тщательно обследовать на предмет вестибулита, особенно если они испытывают боль при проникновении во время полового акта.При вестибулите вестибулярная область на отметках 4 и 8 часов, внешняя по отношению к гименальному кольцу, обычно красная и болезненная даже при легком прикосновении. 27

    Появление выделений из влагалища

    Нормальные выделения из влагалища обычно белые и комковатые, и они скапливаются во влагалище. Напротив, выделения из BV серые и однородные (, т.е. водянистый вид обезжиренного молока), и они присутствуют на передней и боковой стенках влагалища. 20 Candida может вызвать образование «творожного» налета на стенке влагалища, 4 , а трихомониаз часто вызывает гнойные выделения. 28 Характеристики выделений из влагалища достаточно разные, чтобы их можно было использовать при первоначальной классификации (рис. 1). Однако, как правило, конкретный диагноз не может быть поставлен только по внешнему виду выделений, поскольку у большинства пациентов нет «типичного» внешнего вида.

    Рис. 1. Характеристики выделений из влагалища.

    Внешний вид шейки матки

    Во время ранней фазы менструального цикла с преобладанием эстрогена прозрачные слизистые эндоцервикальные выделения являются нормальным явлением.В более поздней прогестероновой фазе цикла цервикальная слизь густая, скудная или незаметная. Выделения из влагалища на эктоцервиксе необходимо удалить с шейки матки ватным тампоном, чтобы проверить наличие гнойных выделений из влагалища. Наличие гнойного отделяемого в эндоцервикальном канале должно указывать на диагноз цервицита. N . gonorrhoeae и C . trachomatis присутствуют примерно у половины женщин с цервицитом. 18 При цервиците может возникнуть эндоцервикальное кровотечение из шейки матки из-за чрезмерной рыхлости столбчатого эпителия.

    Офисный анализ

    pH

    Простой офисный анализ влагалищных выделений полезен и недорого. Результаты позволяют отнести пациентов к одной из двух основных диагностических категорий: нормальные выделения / кандидоз, если pH нормальный, или BV / трихомониаз / десквамативный вагинит, если pH повышен (рис. 1). Индикатор pH должен иметь диапазон от 4 до 6.Уровень pH следует проверить, поместив каплю влагалищных выделений на pH-бумагу или потерев ею стенку влагалища. Следует избегать цервикальной слизи, поскольку она имеет щелочной pH. Нормальный pH практически исключает BV.

    ЗАПАХ АМИНА.

    Капля 10% гидроксида калия (КОН), смешанная с нормальной вагинальной жидкостью, на предметном стекле не производит запаха. 29 Рыбный запах триметиламина встречается у женщин с БВ и у многих женщин с трихомониазом. Запах рыбы вызван улетучиванием в основном триметиламина, который является побочным продуктом анаэробного метаболизма.

    Микроскопический анализ

    Отношение влагалищных выделений к нормальному физиологическому раствору приблизительно 1: 4 смешивают на предметном стекле и покрывают покровным стеклом, чтобы получить влажный раствор физиологического раствора. Смешивают влагалищные выделения с большим соотношением 2: 1 к 10% КОН, ощущают запах амина, и образец покрывают покровным стеклом, чтобы получить влажный образец КОН. Микроскопическое исследование следует проводить в течение нескольких минут после подготовки предметного стекла. На основании предыдущего внешнего вида и химических определений ищется наиболее вероятная характеристика, которую можно идентифицировать с помощью микроскопии (рис.1). Наиболее вероятным признаком у пациентов с pH 4,5 и отсутствием запаха амина является Lactobacillus , что свидетельствует о нормальной флоре или гифах у пациентов с кандидозом. Напротив, микроскописты должны искать ключевые клетки, трихомонады, морфотипы мелких бактерий и лейкоциты (лейкоциты) у пациентов с pH> 4,5 и запахом амина. Систематический анализ нескольких микроскопических особенностей — ключ к точному диагнозу.

    БЕЛЫЕ КЛЕТКИ КРОВИ.

    Несколько лейкоцитов могут присутствовать во влагалище в результате физиологических выделений из шейки матки, особенно в предменструальный период, но их количество обычно не превышает количества вагинальных эпителиальных клеток.Большое количество лейкоцитов указывает на трихомониаз, цервицит или, иногда, на кандидоз. Женщины с десквамативным воспалительным вагинитом (DIV) также имеют большое количество лейкоцитов.

    LACTOBACILLUS МОРФОТИПЫ.

    Выделения женщин с кандидозом или нормальными выделениями обычно содержат преобладание больших палочек, которые при окрашивании являются грамположительными. Эти большие стержни можно увидеть на препарате для влажного крепления и представляют лактобациллы. Их количество обычно уменьшается или они отсутствуют у пациентов с BV, трихомонадной инфекцией или DIV.

    КОРОТКИЕ МОРФОТИПЫ БАКТЕРИЙ.

    В отличие от пациентов с нормальной флорой Lactobacillus , у пациентов с BV, трихомональной инфекцией и DIV обычно преобладают кокки или мелкие коккобациллярные формы и отсутствуют или имеется лишь несколько морфотипов Lactobacillus . Эти мелкие бактерии особенно многочисленны при БВ.

    ТРИХОМОНАДЫ.

    Трихомонады — это подвижные жгутиковые микроорганизмы, которые немного больше лейкоцитов. Полностью подвижные трихомонады легко идентифицировать по характерным волнообразным плавательным движениям.Однако лейкоциты часто препятствуют их подвижности, и примерно у 20% женщин с трихомониазом подвижные трихомонады не наблюдаются при низком 100-кратном увеличении, но бьющиеся жгутики могут быть обнаружены на стационарных трихомонадах при 400-кратном увеличении. Около половины женщин с трихомониазом при посеве имеют слишком мало трихомонад, чтобы их можно было обнаружить с помощью прямой микроскопии. К счастью, у большинства этих пациентов симптомы отсутствуют.

    КЛЕЙНЫЕ КЛЕТКИ.

    Ключ-ключ — это вагинальная эпителиальная клетка, к которой прикрепляется такое большое количество бактерий, что граница клетки не видна и имеет зубчатый вид.Ячейки-подсказки наиболее объективно идентифицируются, наблюдая за отсутствием прямой границы ячеек через объектив 400x. У женщин с БВ от 5% до 50% вагинальных эпителиальных клеток являются ключевыми клетками.

    HYPHAE.

    Гифы идентифицируются на влажном держателе 10% КОН. Гифы имеют характерный вид ветвления, который обычно можно определить с помощью 100-кратного объектива. Следует сканировать всю поверхность покровного стекла, потому что даже у женщин с симптомами гифы могут слипаться только в одной области стекла.Почки дрожжей также могут определить опытные микроскописты.

    ГРАММОВАЯ ПЯТНА.

    Для обнаружения лейкоцитов, преобладающей бактериальной флоры и дрожжевых форм вместо влажного образца можно использовать окраску по вагинальному Граму. Окрашивание по Граму бесполезно для обнаружения трихомонад. У пациентов с БВ преобладает флора мелких грамотрицательных бацилл (, например, Gardnerella spp., Анаэробы) и относительно отсутствует крупная грамположительная палочка (, например, морфотипы Lactobacillus ).Окрашивание по Граму полезно для выявления нормальной, промежуточной флоры и флоры BV. 24 Окраска по Граму более чувствительна, чем влажный образец, для выявления Candida .

    Вагинальные культуры

    Вагинальные бактериальные культуры имеют ограниченную пользу для диагностики вагинита. Культуры следует использовать только в определенных обстоятельствах. Цервикальные тесты на N. gonorrhoeae и C. trachomatis должны быть получены у любой женщины с гнойным экссудатом шейки матки. Гонорейные и хламидийные инфекции также распространены среди женщин с трихомониазом.Тесты на обнаружение ДНК (, т.е. , полимеразная цепная реакция или лигазная цепная реакция) являются наиболее чувствительными и доступными. 30

    Вагинальные посевы на микроорганизмов Candida полезны для женщин с подозрением на кандидоз, но с нормальными результатами подготовки КОН. Посевы Candida должны быть получены от женщин без гиф в мазке КОН, у которых есть зуд, эритематозная сыпь вульвы, трещины вульвы или белые бляшки вульвы, а также у женщин, не реагирующих на противогрибковые препараты.

    Культуры трихомонад на среде Даймонда можно получить в случае гнойных выделений из влагалища, когда повторные микроскопические исследования не позволяют идентифицировать организм. Мокрые мазки выявляют только от 50% до 70% бессимптомных женщин с трихомониазом. 31 Однако эти культуры не всегда доступны во многих клинических условиях.

    Влагалищные посевы на G. vaginalis , другие нормальные бактерии вагинальной флоры или генитальные микоплазмы практически не помогают диагностировать вагинит. G. vaginalis выделены примерно у 50% бессимптомных женщин без вагинита, поэтому их наличие плохо коррелирует с вагинитом и БВ.

    ФИЗИОЛОГИЧЕСКИЕ ВЫДЕЛЕНИЯ из влагалища

    Около 10% женщин с жалобами на выделения из влагалища имеют физиологическое увеличение количества нормальной цервикальной слизи или нормального экссудата влагалищной жидкости. У женщин с физиологическими выделениями обычно отсутствуют аномалии вульвы и белые хлопьевидные (комковатые) выделения из влагалища. Выделения очень густые и имеют тенденцию скапливаться в нижней части влагалища.Поверхности эпителия влагалища и шейки матки имеют нормальный розовый цвет. PH нормального слива обычно составляет менее 4,5, и при нанесении KOH запаха амина отсутствует (рис. 1). Наиболее поразительной находкой под микроскопом является обилие вагинальных эпителиальных клеток и больших палочек, представляющих нормальные грамположительные лактобациллы (рис. 1). Не видно никаких ключевых клеток, трихомонад или мицелия, и только несколько лейкоцитов и бактерий с короткими палочками присутствуют при микроскопии.

    Цервикальная слизь может вызывать обильные выделения, особенно у женщин с большой площадью поверхности столбчатого эпителия шейки матки.У таких женщин в середине цикла обычно наблюдаются чрезмерные выделения. Осмотр шейки матки в середине цикла выявляет большое количество прозрачной цервикальной слизи и, как правило, большую площадь цилиндрического эпителия. Окраска по Граму выделений из шейки матки выявляет только единичные лейкоциты. У этих женщин выделения из влагалища под микроскопом выглядят так же, как физиологические выделения из влагалища. Чтобы исключить их присутствие, необходимо провести анализы на цервикальные гонококки и хламидии.

    Женщины с физиологическими выделениями должны быть уверены, что выделения нормальные и что терапия не требуется.Пациенты с симптомами, которые все еще подозревают, что у них инфекционный вагинит, должны быть повторно обследованы через 1-2 недели. Следует избегать длительного использования тампонов, чтобы предотвратить изъязвление влагалища. Хотя такая практика, как правило, не рекомендуется, некоторые женщины настаивают на спринцевании, и в этом случае следует использовать мягкий раствор уксуса или воду. Тем не менее, многократное высушивание многократных спринцеваний может увеличить количество выделений, а спринцевание коммерческими препаратами может вызвать аномальные сдвиги во влагалищной флоре. 32 Спринцевание не рекомендуется из-за его связи с сальпингитом. 33 Антимикробные схемы не следует назначать женщинам с физиологическими выделениями из влагалища из-за их неэффективности, склонности вызывать кандидоз, стоимости и, что наиболее важно, потому, что их неспособность устранить симптомы создает ненужные опасения. Криокаутеризация, лазерное прижигание, электрическое прижигание и обработка нормального столбчатого эпителия нитратом серебра обычно не требуется при чрезмерных нормальных выделениях из шейки матки.

    КАНДИДИАЗ

    Candida albicans вызывает от 80% до 90% вагинальных грибковых инфекций, а остальные видов Candida и Torulopsis вызывают остальные. 34 Эти сапрофитные грибы могут быть изолированы в небольшом количестве от 5% до 20% бессимптомных женщин. Симптомы обычно возникают только тогда, когда эти организмы размножаются в больших количествах.

    Эпидемиология

    Истинная заболеваемость кандидозным вульвовагинитом неизвестна. Женщины-носители C . albicans в половых путях может протекать бессимптомно или иметь симптомы сильного воспаления. Симптомы отражают иммунный ответ хозяина. Диагноз без использования микроскопии или посева показывает, что у половины женщин с диагнозом кандидоз вместо этого есть другие заболевания. 1 К студенческому возрасту около половины женщин имеют один эпизод кандидоза, диагностированный врачом. 35 Кандидоз увеличивается после менархе, что частично связано с началом половой жизни. 36 , 37 Частота кандидоза увеличивается во время беременности. Женщины в постменопаузе, получающие заместительную терапию эстрогенами, могут иметь кандидоз.

    Частота половых контактов связана с кандидозом. 36 , 37 Количество половых партнеров 36 и орально-генитальный контакт 37 не увеличивает заболеваемость кандидозом. Кандидоз, по-видимому, слабо связан с противозачаточными таблетками с высокими дозами эстрогена. 38 Половой акт с использованием спермицида ноноксинола-9, по-видимому, увеличивает колонизацию Candida. 39 Спринцевание коммерческими продуктами, по-видимому, временно изменяет флору влагалища 32 и периодически было связано с рецидивирующей инфекцией Candida . 36 , 37

    Антибиотики сильно связаны с кандидозом, 40 , и эта связь может быть особенно важной для женщин с рецидивирующей инфекцией. 41 Неясно, убивают ли антибиотики бактерии, такие как Lactobacillus , которые могут подавлять рост Candida , или используют другие механизмы. 6

    Диета может мало играть роль кандидоза. 42 Гигиенические практики, включая частое опорожнение кишечника, направление вытирания после опорожнения кишечника, тип защиты от менструации, ткань нижнего белья и тесную одежду, не играют роли при кандидозе. 37 Иммуносупрессия от ВИЧ-инфекции связана с C . torulopsis инфекция 34 и повышенные показатели пищеводного и, возможно, вагинального C . albicans инфекция. Неконтролируемый диабет связан с кандидозом, особенно с нечувствительными инфекциями.

    Диагноз

    Рецидивы типичных тяжелых симптомов, таких как зуд и раздражение вульвы, часто представляют собой кандидоз, но примерно в половине случаев самостоятельно диагностируются атипичные или минимальные симптомы. 43 Помимо обнаружения низкого pH и ранее обсужденных результатов микроскопии, посевы необходимы женщинам с подозрением на кандидоз, у которых результаты микроскопии для Candida отрицательны.Среди положительных по культуре женщин с вульварными симптомами наружной дизурии, зуда, отека или покраснения мокрый анализ КОН был положительным только около 60%, в результате чего 30% женщин не диагностировались с помощью КОН. 4

    Неосложненный кандидоз относится к спорадическим нечастым эпизодам с легкими или умеренными симптомами у нормальной небеременной женщины. Фактически все неосложненные инфекции вызываются C . Альбиканс . Осложненный кандидоз — это рецидивирующая инфекция, инфекция с тяжелыми симптомами или инфекция у беременных, диабетических женщин или женщин с ослабленным иммунитетом.Многие случаи осложненной инфекции вызываются не видами albicans, а видами.

    Лечение

    НЕЧАСТНАЯ, НЕОСЛОЖНЕННАЯ ОСТРАЯ ИНФЕКЦИЯ.

    Местная терапия азолами остается препаратом первого выбора для лечения нечастого острого кандидоза. Азолы обладают фунгистатическим действием, поскольку они ингибируют синтез эргостерина (и мембран). Candida организмов уничтожаются лимфоцитами хозяина посредством клеточно-опосредованных иммунных механизмов. Только ограниченный фунгицидный эффект может быть достигнут за счет высокой концентрации азолов, вызывающих прямое повреждение мембран.Азолы для местного применения эффективны, хорошо переносятся и относительно недороги. Доступные продукты включают буконазол (Фемстат), клотримазол (Гин-Лотримин, Мицелекс), миконазол (Монистат) и терконазол (Теразол). Доступен широкий диапазон доз в форме кремов и суппозиториев (Таблица 2). Для некоторых препаратов интервал лечения был увеличен до двух раз в день или доза была увеличена со 100 до 200 мг, в то время как продолжительность лечения была сокращена с 7 до 3 дней. Показатели излечения для 3-дневного курса были равны более длительным курсам для неосложненного кандидоза.Кратковременное (от 7 до 30 дней) излечение при использовании местных азолов в течение от 3 до 7 дней обычно составляет от 80% до более 90%. Нет никаких предположений о том, что скорость излечения различается для разных азолов или между суппозиторием и кремом.

    ТАБЛИЦА 2. Рекомендуемые схемы лечения вульвовагинальным кандидозом азолом

    Азол

    Интравагинальная доза

    Бутон

    )

    2% крем hs

    3 дня

    Клотримазол (Gyne-Lotrimin, Mycelex)

    100 мг таблетки 2 раза в день

    100 мг таблетки hs

    7 дней

    1% крем HS

    7 дней

    -мг суппозитории HS

    3 дня

    Суппозитории 100 мс hs

    7 дней

    Терконазол (теразол)

    Суппозитории 80 мг hs

    дней

    0.4% крем hs

    7 дней

    Флуконазол

    Таблетка 150 мг

    1 доза

    Я не рекомендую однократную терапию что однодневные курсы менее эффективны, чем указывают опубликованные отчеты. Частично это может быть объяснено тенденцией включать в исследования женщин с легкими краткосрочными симптомами и отсутствием кандидоза в анамнезе.Обычно сообщается только о краткосрочных (от 7 до 30 дней) показателях клинического излечения, а более высокая частота микологических неудач происходит через 30 дней, когда пациентам вводят однократную дозу, по сравнению с более длительным курсом терапии. 44 Однако нет уверенности в том, что повышенная скорость выздоровления Candida после лечения связана с увеличением частоты последующего клинического кандидоза, и продолжительность терапии может иметь меньшее значение при неосложненной спорадической инфекции, чем в случаях осложненной инфекции. .

    Пероральный азол флуконазол делает пероральные препараты безопасным выбором при вагинальном кандидозе. Одноразовая пероральная доза 150 мг эффективна для пациентов с легкими или умеренными симптомами. 45 Этот препарат стал популярным среди пациентов, потому что вагинальный крем не используется, и среди врачей, потому что краткосрочное применение не вызывает токсического воздействия на печень, а это проблема, которая помешала широкому использованию кетоконазола. Однако для очень симптоматических пациентов дозу часто необходимо повторять через 4–5 дней из-за высокой частоты неудач, которая в противном случае превышает частоту неудач местной терапии. 45 Врачам необходимо знать о лекарственном взаимодействии между флуконазолом и антигистаминными препаратами, которые удлиняют интервал QTc, пероральными гипогликемическими средствами, кумадином и другими лекарственными средствами (см. Справочник лекарств). 46 Среди пациентов без иммуносупрессии широкое применение, вероятно, не приводит к развитию устойчивости.

    Местная полиеновая терапия, состоящая из нистатина, в значительной степени заменена местным лечением азолом. Нистатин хорошо переносится и недорог, но показатели излечения от 50% до 80% ниже, чем у азолов.Нистатин — препарат второй линии для лечения неосложненного кандидоза.

    Капсулы с борной кислотой (600 мг или порошок борной кислоты в желатиновых капсулах 0 размера), вводимые дважды в день в течение 14 дней, обеспечивают клиническое излечение, аналогичное действию азолов для местного применения. 47 Ион бора в крови не обнаружен, 48 борная кислота недорогая и хорошо переносится. Однако борная кислота может вызвать язвы пищевода при непреднамеренном проглатывании, поэтому препарат следует хранить во флаконах с крышками, защищенными от доступа детей, в закрытой аптечке и использовать с осторожностью, когда маленькие дети находятся в доме.Из-за недоказанной безопасности для плода борную кислоту нельзя использовать во время беременности. Лечение генцианвиолетом эффективно для лечения кандидоза, но окрашивание одежды и кожи ограничивает его использование в редких случаях, когда не поддаются лечению другие лекарства. Сорбат калия и повидон-йод имеют ограниченную эффективность против кандидоза.

    Местное Терапия Candida обычно хорошо переносится, и реакции возникают необычно. Если при использовании возникает повышенное раздражение влагалища, прием лекарства следует немедленно прекратить и заменить на другой препарат.Большинство этих раздражений возникает в результате реакции на «неактивные» соединения в составе крема.

    БЫСТРО РЕЦИОНАЛЬНАЯ ИНФЕКЦИЯ.

    Пациенты, у которых симптомы вернулись через несколько дней после завершения курса лечения, обычно принимали только короткий курс или не соблюдали его. Часто бывает достаточно более длительного курса или другой подготовки. Устойчивость Candida к противогрибковым препаратам встречается редко, а у некоторых пациентов с постоянными симптомами наблюдаются другие заболевания. Пациенты с быстрым рецидивом должны иметь документально подтвержденный кандидоз с помощью мокрого образца КОН, посева или того и другого.Пациенты без объективных доказательств наличия Candida , но со стойкими симптомами должны быть обследованы на предмет вагинита или вульвита, вызванного другими состояниями. Следует учитывать нейродермит, красный плоский лишай, склероз лихена, синдром жжения вульвы и незначительное воспаление вестибулярных желез.

    У небольшого числа пациентов с лекарственной устойчивостью обычно наблюдается уменьшение симптомов во время лечения, но быстрое повторение симптомов после прекращения приема лекарств. C. albicans почти одинаково чувствителен ко всем азолам.Однако устойчивость к азолам чаще встречается среди необычных грибов, таких как Candida glabrata, Candida tropicalis или других видов Candida , не относящихся к albicans, 49 , и при наличии этих грибов следует учитывать возможную устойчивость. Можно попробовать лечение терконазолом, поскольку он обладает большей активностью, чем другие азолы, против C. glabrata и C. tropicalis . Пациентов можно перевести на ноназольные препараты, нистатин или борную кислоту. Борная кислота более эффективна, чем флуконазол, для лечения вульвовагинального кандидоза, отличного от albicans . 49 , 50 Терапия генцианвиолетом также может принести пользу. В редких случаях ни одно из местных лекарств не эффективно для устранения вагинальных грибков, и нистатин или борную кислоту необходимо вводить каждые 2–3 дня на неопределенный срок, чтобы подавить, а не устранить резистентные грибки.

    Неудачи лечения кандидоза были настолько редкими, что систематические исследования для определения причин неудач лечения не проводились. Период наблюдения был слишком коротким (30 дней или меньше), чтобы точно оценить частоту неудач.Были упомянуты несоблюдение рекомендаций, псевдонарушения из-за реакции на носитель и устойчивость к лекарствам. Две другие известные теории неудач лечения требуют обсуждения.

    Первая теория гласит, что рецидивирующий вагинальный кандидоз возникает из желудочно-кишечного тракта. Candida. Микроорганизмы Candida чаще встречаются в полости рта и желудочно-кишечном тракте пациентов с кандидозом, чем в контрольной группе. 51 Однако большинство пациентов переносят Candida в желудочно-кишечном тракте без развития вагинального кандидоза, и в долгосрочных исследованиях вагинальный кандидоз не был связан с желудочно-кишечным кандидозом Candida. Пероральная терапия нистатином дала неоднозначные результаты. Пероральный нистатин не оказал заметного эффекта, хотя небольшое статистически значимое снижение последующего вульвовагинита Candida произошло в группе, получавшей пероральный нистатин, по сравнению с плацебо. 52 Употребление 4 унций йогурта, содержащего лактобациллы, два раза в день также обеспечило умеренное сокращение рецидивов. 53

    Вторая теория предполагает передачу рецидивирующего кандидоза половым путем.Половые партнеры-мужчины у пациенток с вагинальным кандидозом имеют более высокие показатели колонизации гениталий, чем в контрольной группе. 54 Передача половым путем, вероятно, действительно происходит у небольшого числа (по оценкам, от 10% до 15%) мужчин, у которых Candida баланит сочетается с вагинальным кандидозом их партнера. Однако только 20% половых партнеров-мужчин заражены грибами Candida , и лечение мужчин не уменьшило вагинальный кандидоз у женщин. Большинство мужчин выглядят пассивно колонизированными самками, а не играют главную роль в рецидивирующем вагинальном кандидозе.

    АДЮНКТИВНОЕ ЛЕЧЕНИЕ.

    Временное уменьшение симптомов вульвы происходит с помощью сидячей ванны с последующим пересушиванием кожи феном при низкой температуре. Кремы с азолом для местного применения также могут быть прописаны для прямого применения вульвы, но информации об их эффективности мало.

    Диета для снижения высокого уровня углеводов оказалась полезной для подгруппы пациентов, у которых развился кандидоз вскоре после приема необычно большого количества сахара.Среди диабетиков лечение кандидоза обычно не приносит успеха, пока не будет достигнут контроль уровня глюкозы. Популяризуется отказ от продуктов, приготовленных из дрожжевых грибов, но научных данных об их эффективности нет. Дрожжевые организмы в пище — это не те виды, которые вызывают вагинит. Дрожжи, вызывающие вагинит, настолько распространены в окружающей среде и на коже, что трудно поверить, что бездрожжевая диета влияет на вагинальный кандидоз. Прекращение антибактериальной терапии может быть рассмотрено, когда это возможно, у небольшого числа пациентов, постоянно принимающих противомикробные препараты.Прекращение приема оральных контрацептивов спорно и, вероятно, имеет ограниченную пользу. Отказ от тесной, плохо вентилируемой одежды, вероятно, принесет мало пользы.

    ХРОНИЧЕСКАЯ РЕЦИОНАЛЬНАЯ ИНФЕКЦИЯ.

    У значительной части пациентов были выявлены хронические или часто повторяющиеся (не менее четырех раз в год) эпизоды вагинального кандидоза. Эти пациенты составляют значительное число пациенток с вагинальным кандидозом, посещающих определенные клиники.

    Неясно, имеют ли пациенты с хроническим рецидивирующим кандидозом ограниченный иммунологический дефект, при котором лимфоциты не убивают Candida организмов во влагалище, или другие причины рецидива.Рецидив не связан с необычными или устойчивыми к лекарствам штаммами Candida , и лишь немногие пациенты страдают диабетом или принимают оральные контрацептивы, иммунодепрессанты или антибиотики. Женщин с частыми рецидивами вагинального кандидоза или кандидоза, которые не поддаются лечению, следует рассмотреть для прохождения тестирования на ВИЧ. Однако немногие женщины с рецидивирующим кандидозом имеют ВИЧ или какой-либо другой общепризнанный фактор, предрасполагающий пациентов к кандидозу.

    Симптоматическое заболевание часто трудно поддается лечению, но важным прорывом стала хроническая супрессивная терапия, аналогичная той, которая используется при инфекциях мочевыводящих путей.В первоначальном исследовании использовалась терапевтическая доза 400 мг перорального кетоконазола в течение 14 дней с последующей поддерживающей дозой в течение 6 месяцев. 55 Потенциальная токсичность для печени и расходы ограничивают использование кетоконазола, и теперь 14-дневный режим должен включать флуконазол, вводимый каждые 4 дня, или вагинальный азол. В контролируемом исследовании частота рецидивов кетоконазола через 6 месяцев составила 70% для тех, кто принимал плацебо, и 5% для тех, кто принимал кетоконазол ежедневно. 55 Практические схемы обслуживания включают два раза в неделю или еженедельно актуальное введение азола. 56 Аналогичные результаты достигаются при пероральном применении итраконазола или флуконазола в качестве поддерживающей борной кислоты или местного применения. 57 Рецидив вагинального кандидоза может возобновиться с той же скоростью, что и до подавления после прекращения поддерживающей терапии. 55

    ЛЕЧЕНИЕ ПРИ БЕРЕМЕННОСТИ.

    Системная абсорбция азолов или нистатина из влагалища настолько ограничена, что их можно безопасно использовать в течение всех триместров беременности. Борная кислота, флуконазол, итраконазол и кетоконазол не следует применять во время беременности.По сравнению с небеременными женщинами кандидоз во время беременности более устойчив к лечению, с большей вероятностью рецидивирует и лучше реагирует на 7- или даже 14-дневную терапию по сравнению с 1-3-дневной терапией.

    ТРИХОМОНИАЗ

    T. vaginalis — это повсеместный анаэробный паразит, передающийся половым путем. T. vaginalis был связан с вагинитом, атипичными цитологическими мазками и другими инфекциями, передаваемыми половым путем. До половины женщин с гонореей также страдают трихомониазом. 58 Воспаление, вызванное Trichomonas , может увеличить передачу ВИЧ в два-три раза. 59 По оценкам, во всем мире инфицировано 200 миллионов человек. С 1970-х годов в США наблюдается постепенное снижение числа людей, пролеченных от трихомониаза, 60 , возможно, связанных с лечением БВ метронидазолом. Однако только у 50% женщин с трихомонадами есть симптомы. 61

    T. vaginalis передается исключительно половым путем.Организм существует во влагалище, уретре, мочевом пузыре, а также во бартолиновых и скеновых железах. Инфекция чаще всего встречается у молодых сексуально активных женщин, особенно с новым партнером. 7 Хотя трихомонозная инфекция необычна для студентов колледжей, она была вылечена более чем у 12% беременных городских женщин, в основном женщин с низким социально-экономическим статусом. 62 Более двух третей женщин и до 60% мужчин страдают трихомониазом, когда их половой партнер был признан инфицированным. 63 , 64 Значительное количество мужчин являются носителями этого организма в течение длительного времени, хотя некоторые мужчины излечиваются без лечения.Мужчины, контактировавшие с ними, с большей вероятностью являются носителями трихомонад, если они будут обследованы в течение 6 дней с момента их последнего контакта, но 33% контактировавших с ними мужчин были носителями трихомонад через 6–60 дней после последнего контакта. 65 Этот микроорганизм присутствовал в 14-60% мужчин, контактировавших с женщинами с трихомониазом в 19 исследованиях, что подтверждает передачу половым путем и необходимость лечения партнеров-мужчин. 66

    T. vaginalis вызывает клеточный и гуморальный иммунный ответ.Однако эти ответы не защищают от повторного заражения, которое является обычным явлением. Полиморфно-ядерный лейкоцитарный ответ на T. vaginalis часто бывает интенсивным и связан с количеством организмов. 67

    Диагноз

    Женщины с симптомами обычно жалуются на обильные, зловонные и часто неприятные выделения из влагалища, которые вызывают внутреннюю и внешнюю дизурию. 28 Также может присутствовать ощущение полноты вульвы и влагалища и болезненность в нижней части живота.Симптомы обычно обостряются во время менструации.

    При осмотре вульва может быть слегка эритематозной и отечной. Вульва и влагалище могут быть покрыты зелеными или желтыми гнойными, пенистыми и пахнущими выделениями. 28 Классические выделения встречаются только у трети женщин. Небольшие участки субэпителиальной гиперемии влагалища и шейки матки обычно требуют кольпоскопии для идентификации, но иногда эти области выявляются на эпителии шейки матки ( i.е. шейка матки клубники) невооруженным глазом. Эта находка характерна для трихомониаза. 28 , 67

    Инфекция, передающаяся половым путем, часто встречается у женщин с трихомониазом. Сопутствующая болезненность слизистой шейки матки, матки и живота часто обнаруживается у женщин с трихомониазом, и если эти признаки присутствуют, женщинам необходимо пройти обследование на наличие других инфекций, таких как гонорея и хламидиоз. Однако T. vaginalis нечасто выделяется из маточных труб женщин с сальпингитом и, по-видимому, не вызывает инфекцию верхних половых путей у небеременных женщин.Исключение может быть во время беременности, поскольку повышенный риск преждевременных родов у женщин с трихомониазом возникает на сроке от 23 до 26 недель беременности независимо от других половых инфекций. 68

    Диагноз трихомониаза ставится на основании лабораторных исследований. У женщин с трихомониазом часто наблюдается повышенный уровень pH влагалища, запах амина и колонизация видов Gardnerella и Bacteroides . 25 В клинической практике инфекция обычно проявляется при обнаружении подвижных трихомонад в выделениях из влагалища с помощью микроскопии влажного солевого раствора. 31 Различные пятна трихомонад на препарате предметного стекла, как правило, менее чувствительны, чем влажный образец, и хотя метод полимеразной цепной реакции более чувствителен, чем влажный образец, 69 он слишком дорог для рутинного использования. Сообщения о наличии трихомонад в мазках Папаниколау (Пап) должны требовать подтверждения с использованием мокрого образца или посева из-за высокого уровня ложноположительных результатов при идентификации мазков Папаниколау. 31 Посевы следует проводить только женщинам с неустановленными хроническими симптомами и отрицательным результатом мокрого анализа.Посевы выявляют на 50% больше женщин с трихомониазом, чем только мокрый анализ. 31 Около половины женщин с трихомониазом имеют низкую концентрацию микроорганизмов, но, к счастью, у большинства этих женщин симптомы отсутствуют или отсутствуют. Культуры полезны в исследовательских целях, и средства массовой информации Даймонда работают лучше, чем другие средства массовой информации. 70

    Лечение

    Метронидазол, 5′-нитроимдиазол, является единственным эффективным лекарством, одобренным для лечения трихомониаза в США.Пероральная терапия обеспечивает адекватный уровень лекарств при вагинальных, периуретральных, уретральных инфекциях и инфекциях мочевого пузыря. T. vaginalis содержит ферредоксины, белки с низким окислительно-восстановительным потенциалом, которые играют важную роль в метаболизме анаэробных микроорганизмов, таких как T. vaginalis . 5′-нитроимидазолы для уничтожения требуют восстановления нитрогруппы, которая окисляет ДНК, вызывая повреждение ДНК и последующую гибель клеток. Аэробные условия мешают этому процессу восстановления и снижают эффективность метронидазола. 71 T. vaginalis обычно чувствителен к метронидазолу при концентрации менее 1 мкг / мл в анаэробных условиях, но при более высоких концентрациях в аэробных условиях. 71 Метронидазол в разовой дозе 2 г дает пиковые уровни в сыворотке 40 мкг / мл. Период полувыведения метронидазола из сыворотки крови составляет около 8 часов. 72 Результаты лечения обычно отражают восприимчивость in vitro, , 73 и необычный пациент, который не проходит лечение стандартными дозами метронидазола, имеют повышенную устойчивость к метронидазолу in vitro . 74

    Рекомендуемое лечение состоит из 2 г метронидазола в виде стандартной разовой дозы или 500 мг метронидазола два раза в день в течение 7 дней (таблица 3). Наиболее часто изучалась схема приема 250 г трижды в день в течение 7 дней, но период полувыведения метронидазола поддерживает использование режима дозы 500 мг два раза в день. Поскольку статический и 7-дневный режимы одинаково эффективны для лечения неосложненного трихомониаза, статическая доза является предпочтительной из-за большей комплаентности по сравнению с 7-дневным режимом.Показатели излечения выше 95% обычно сообщаются при любом режиме, 75 , особенно когда лечение также получают сексуальные партнеры-мужчины. 76

    ТАБЛИЦА 3. Рекомендуемые схемы лечения трихомониаза

    Неосложненная инфекция

    Доза метронидазола

    49

    49

    Рекомендуемый

    2 г

    Пероральный

    Однократная доза

    Альтернатива или при повторяющейся неисправности

    , 2 раза в день в течение 7 дней

    Документально подтвержденная неудача лечения

    1 г

    Пероральный

    2 раза в день 7-14 дней

    4

    Вагинальный

    9 0140

    два раза в день в течение 7 — 14 дней


    * Полового партнера необходимо одновременно лечить.

    Тошнота, наиболее частый побочный эффект, возникает примерно у 10% пациентов после приема однократной дозы 2 г. 75 Металлический привкус, головная боль, головокружение и темная моча также возникают при использовании метронидазола. Пациентам следует рекомендовать воздерживаться от употребления алкоголя в течение 24 часов после приема последней дозы метронидазола из-за дисульфирамоподобного эффекта, вызывающего тошноту при одновременном приеме алкоголя. Метронидазол может продлить тромбиновое время у людей, принимающих кумадин. 77

    Мутагены были обнаружены в моче женщин, принимающих метронидазол.Метронидазол канцерогенен для животных, 78 , и его следует рассматривать как слабый канцероген, способный вызывать повреждение ДНК, что вызывает опасения по поводу увеличения заболеваемости раком среди бывших потребителей метронидазола. Два относительно небольших ретроспективных исследования не показали связи между метронидазолом и раком. 79 , 80 Частота некоторых видов рака среди пользователей метронидазола была немного выше по сравнению с контрольной группой, хотя с относительным риском менее 2.Однако исследования слишком малы, чтобы выявить эффект при повышении риска менее чем в два раза, а слабые канцерогены часто связаны с коэффициентом риска ниже 2. Данные также неполны из-за короткого периода наблюдения по сравнению с периодом наблюдения до 30 лет. латентный период клинического рака. Врачи не должны забывать о возможном канцерогенном эффекте метронидазола.

    СЕКСУАЛЬНАЯ ПАРТНЕРСКАЯ ТЕРАПИЯ.

    Для предотвращения повторного заражения рекомендуется сопутствующая терапия мужского полового партнера.Мужчины часто могут сопротивляться терапии, потому что обычно они протекают бессимптомно. Показатели излечения женщин увеличиваются на 10–25%, если лечить также мужчин. Сообщалось о 97% излеченности при приеме 2 г и 7-дневном режиме, когда заключенных женщин лечили без повторного контакта с партнерами-мужчинами. 81 , 82 Мужская терапия также снижает распространение трихомонадной инфекции среди других женщин.

    ЛЕЧЕНИЕ АСИМПТОМНЫХ ЖЕНЩИН.

    Бессимптомным женщинам, у которых обнаружен трихомониаз, следует предложить терапию для уменьшения передачи половым путем.Терапию также следует назначать пациентам с атипичными воспалительными мазками Папаниколау и T. vaginalis.

    НЕИСПРАВНОСТЬ ЛЕЧЕНИЯ.

    Возможное нарушение режима лечения следует искать у пациентов, которые первоначально получали 7-дневный режим. Поскольку пациенты со стойким трихомониазом также могут иметь повторное инфицирование, им и их партнерам следует повторно назначить 7-дневный режим. Показатели излечения после повторного лечения остаются высокими при стандартных схемах лечения.

    Клиническая резистентность Т.vaginalis к метронидазолу сообщается у небольшого числа пациентов даже после двух-трехкратного приема обычной дозы препарата. 74 Существует общая корреляция между восприимчивостью in vitro и показателями клинического излечения, но клиническая и лабораторная эффективность не коррелируют так же для T. vaginalis , как и при тестировании на чувствительность к бактериям. Тем не менее, средняя восприимчивость in vitro T. vaginalis у женщин, устойчивых к стандартной терапии метронидазолом, была примерно в восемь раз выше, чем чувствительность стандартных изолятов. 74

    Пациенты, которые не реагируют на обычные дозы метронидазола, соблюдают предписания и не подвергались повторному контакту с партнерами-мужчинами, должны получать лечение с увеличенной дозой и продолжительностью приема препарата. Эти случаи были нечастыми, и единой схемы лечения не установлено. Один из режимов, который, по моему мнению, оказался полезным, представлен в Таблице 3. В целом пациенты, у которых стандартная терапия оказалась неэффективной, отвечали на ежедневную пероральную дозу метронидазола в дозе 2 г, вводимую с интравагинальной дозой метронидазола 1000 мг в течение 7–14 дней.Большинство пациентов испытывают сильную тошноту при ежедневном приеме 3 г или более метронидазола, но обычно они могут завершить лечение. Внутривенное введение использовалось для клинически устойчивых случаев, 83 , но этот режим дорог, токсичен и, вероятно, не нужен, поскольку пероральный метронидазол хорошо всасывается. Если требуются высокие дозы метронидазола, следует проконсультироваться со специалистом по инфекционным заболеваниям. Ежедневное введение от 4 до 6 г или более метронидазола было связано с судорогами и возможностью вывести из строя периферическую невропатию. 84

    Тинидазол с более длительным периодом полувыведения, чем метронидазол, также использовался для лечения резистентного трихомониаза. 85 в обычной дозе в течение вдвое большей продолжительности. Однако тинидазол недоступен в США. Сообщалось, что местный клотримазол лечит трихомониаз, 86 , но клинический опыт свидетельствует о низком уровне излечения. Другие препараты, которые следует учитывать пациентам с резистентным трихомониазом или пациентам с аллергией на метронидазол, включают местный 6% парамицин 87 и ноноксинол-9. 88

    ЛЕЧЕНИЕ ПРИ БЕРЕМЕННОСТИ.

    Лечение трихомониаза метронидазолом во время беременности является спорным вопросом. Несмотря на связь T. vaginalis с недоношенными, 68 существует мало свидетельств того, что микроорганизм проникает в матку или плаценту. Лечение во время беременности оправдано при появлении симптомов, но не для уменьшения недоношенности. Метронидазол вводили большому количеству беременных женщин, и для небольшого числа беременных женщин с данными об исходах метронидазол не был связан с признанными тератогенными или другими неблагоприятными неонатальными эффектами. 89 Однако метронидазол обладает мутагенным и канцерогенным потенциалом, и, хотя степень этих эффектов не определена, есть основания для разумного использования метронидазола во время беременности.

    При беременности возможно несколько модификаций терапии. Следует избегать лечения в первом триместре, когда новорожденный наиболее чувствителен к действию лекарств, и назначать его пациентам с умеренными и тяжелыми симптомами во втором и третьем триместре. Клотримазол может временно уменьшить симптомы, хотя излечение происходит редко.Бессимптомные пациенты или пациенты с минимальными симптомами не должны получать лечение во время беременности, но они могут получить 2 г метронидазола в день родов. Уровни препарата в грудном молоке равны уровням в сыворотке крови, и кормление грудью можно отложить на 24 часа, чтобы ограничить уровни, присутствующие в грудном молоке.

    БАКТЕРИАЛЬНЫЙ ВАГИНОЗ

    BV является наиболее частой причиной вагинальных инфекций. БВ, по-видимому, вызывает инфекцию верхних отделов половых путей, что контрастирует с другими формами вагинита, и эта черта еще раз подтверждает важность БВ.Причина BV далеко не ясна. BV может быть вызван чрезмерным ростом определенных бактерий во влагалище, но он также может быть вызван неспособностью Lactobacillus обеспечить ингибирующий контроль над другой вагинальной флорой. Конечным результатом является чрезмерный рост потенциально вирулентных микроорганизмов во влагалище, что вызывает усиление выделений и запаха из влагалища, а также увеличение инфекции верхних половых путей.

    БВ является обычным явлением в большинстве популяций, но распространенность БВ зависит от популяции.Это особенно часто встречается в клиниках по лечению заболеваний, передающихся половым путем (ЗППП), в отличие от клиник по планированию семьи или женских консультаций; среди женщин с жалобами на выделения из влагалища; в более низких социально-экономических (особенно афроамериканских) группах; и в Африке к югу от Сахары. Распространенность БВ колеблется от 4% у бессимптомных студентов университетов до 15-25% среди невыбранных пациентов, посещающих гинекологические клиники, и от 30% до 60% в популяциях ЗППП. 90 В Уганде 51% из почти 5000 сельских женщин имели БВ. 91 Во время беременности распространенность БВ составляет от 12% до 20%, 14 , 92 , и эти цифры показывают диапазон БВ у молодых сексуально активных женщин в США.

    Эпидемиология

    Роль передачи половым путем в развитии БВ неясна. В первоначальных исследованиях прививка инфицированных выделений из влагалища от женщин с BV добровольцам вызвала заболевание, 16 , но прививка G. vaginalis , выращенных в лаборатории, не вызвала BV. 93 G. vaginalis обычно выделяется из уретры мужчин половых партнеров женщин с БВ. 16 , 94 В проспективных когортных исследованиях новый или несколько половых партнеров повышали риск развития БВ. 7 , 95 , 96 Конкордантность БВ в лесбийских парах также предполагает передачу половым путем. 97 Однако существуют скудные данные о другой мужской флоре уретры в сексуальных контрактах женщин с БВ, а передаваемые микроорганизмы не идентифицированы.Лечение половых партнеров-мужчин женщин с БВ не повлияло на последующее развитие БВ у женщины. 98 , 99 , 100

    Возможно, что какой-то другой косвенный микробный механизм, связанный с половым актом, приводит к БВ. Например, ингибирование Lactobacillus спермой или другими бактериями, непосредственно не участвующими в BV, во время полового акта также может вызывать BV, устраняя контролирующее влияние Lactobacillus .Отсутствие H 2 O 2 , продуцирующих Lactobacillus и отсутствие организмов Lactobacillus , было фактором приобретения BV. 7 Другие факторы, нарушающие флору влагалища, такие как использование внутриматочной спирали 95 , 101 и спринцевание 7 , по-видимому, увеличивают риск БВ. Недавнее использование антибиотиков, 7 , 95 использование противозачаточных средств, 7 и возраст не были связаны с БВ, хотя гормональные факторы могут играть определенную роль, поскольку БВ поражает в основном женщин репродуктивного возраста. 102

    Бактериология

    Нормальная микрофлора влагалища состоит преимущественно из видов Lactobacillus , которые составляют от 90% до 95% от общего числа бактерий. 23 Lactobacillus присутствует в концентрациях от 10 5 до 10 8 колониеобразующих единиц / мл у женщин с нормальным вагинальным окрашиванием по Граму, 23 и у большинства женщин с доминантной флорой Lactobacillus H 2 O 2 -продуцирующих Lactobacillus . 21 , 23 В отличие от женщин с доминирующей флорой Lactobacillus , одна треть женщин с BV не имеют Lactobacillus , а у остальных более низкие концентрации обычно не-H 2 O 2 -продуцирующих Lactobacillus . 21 , 23 У женщин с БВ частота и концентрация увеличивается на G . vaginalis , отобранные грамотрицательные палочковые анаэробные бактерии, видов Mobiluncus и Mycoplasma hominis . 23 , 101 , 103 , 104 У женщин с БВ концентрация G . vaginalis увеличивается в 20–100 раз, а грамотрицательные анаэробы и M . hominis в 20–100 раз по сравнению с Lactobacillus -доминирующей флорой. 23 , 105 В сочетании с высокими концентрациями G . vaginalis и анаэробы, Lactobacillus исчезают или концентрация Lactobacillus снижается примерно в 10 раз в BV. 23 , 105 Это увеличение концентрации потенциально вирулентной флоры, вероятно, объясняет, почему БВ связан с инфекцией верхних половых органов. В других условиях инфекция напрямую связана с концентрацией вирулентных микроорганизмов. Способность этих бактерий вторгаться в условиях BV, вероятно, усиливается за счет продукции нескольких молекул посредством бактериального метаболизма, включая сиалидазу 106 и протеазу, которые могут усиливать инвазивные свойства, способность подавлять иммунную резистентность с помощью сукцината, 107 и расщепление секреторного IgA некоторыми штаммами G.vaginalis 108 и, вероятно, другими механизмами.

    Большинство женщин с преобладающей флорой, содержащей Lactobacillus , имеют лактобациллы, которые продуцируют H 2 O 2 , которые могут подавлять многие бактерии, особенно каталазонегативные бактерии, у которых нет фермента, выводящего токсины H 2 O 2 . Совместное присутствие H 2 O 2 с ионом галогенида, таким как хлорид и пероксидаза, вызывает еще большее подавление бактерий и вирусов.Хлорид транссудата и пероксидазы сыворотки присутствуют во влагалище, 22 , и продукция H 2 O 2 посредством Lactobacillus обеспечивает третий компонент относительно мощной системы, которая может убивать микроорганизмы. В концентрациях, которые присутствуют во влагалище, три комбинированных компонента этой системы подавляют бактерии и вирусы, включая ВИЧ in vitro . 9

    Напротив, женщины с БВ обычно не имеют H 2 O 2 -продуцирующих Lactobacillus и не обладают ингибирующим действием на другую флору.Флора в BV сложна и, возможно, действует согласованно. Например, прививка G . vaginalis или Mobiluncus sp. Само по себе во влагалище не вызывало признаков вагинита в модели гривеновой обезьяны, но одновременное введение обеих этих бактерий во влагалище приводило к выделению из влагалища. 109 Лечение БВ метронидазолом, лекарственным средством, не подавляющим M . hominis , снижает распространенность M . hominis вернулся к уровням, наблюдаемым у женщин без BV. 110

    Характерный запах, присутствующий в BV, по-видимому, связан с производством аминов в ходе метаболизма бактерий, присутствующих в BV. Нанесение КОН на выделения из влагалища приводит к улетучиванию аминов, которые связываются с белками при щелочном pH. Женщины часто жалуются на усиление запаха во время полового акта, когда семенная жидкость вызывает аналогичное временное ощелачивание влагалищной жидкости. Обнаруженные амины включают триметиламин, который, вероятно, производит большую часть характерного запаха, а также путресцин и кадаверин. 111

    При использовании BV происходит значительное увеличение концентрации сукцината и других органических кислот. 33 Сукцинат подавляет хемотаксический ответ лейкоцитов. 107 Повышенные уровни эндотоксина, сиалидазы и муциназы могут еще больше усилить способность бактерий проникать через шейку матки в верхние отделы половых путей. 106 , 112 , 113

    Диагноз

    Женщины с БВ жалуются на запах из влагалища и усиление выделений из влагалища. 20 Зуд и раздражение вульвы не являются симптомами БВ. Симптомы и признаки особенно разнообразны при БВ, и диагноз может быть установлен только с помощью лабораторных исследований.

    Клинические критерии для диагностики BV включают три из следующих: pH выше 4,5, однородный (обезжиренное молоко) внешний вид, запах амина с добавлением KOH и клетки-подсказки при микроскопии. 29 Нормальный pH 4,5 является хорошим отрицательным предиктором BV, потому что нормальный pH обнаруживается менее чем у 3% женщин с BV. 20 Ключ-клетки сами по себе обладают высокой предсказательной силой для BV. 114 Диагностика BV окрашиванием по Граму с использованием небольшого количества морфотипов Lactobacillus (грамположительные палочки) и большого количества G. vaginalis и анаэробных морфотипов (маленькие грамотрицательные палочки) также позволяет прогнозировать BV. 24 BV может быть обнаружен в мазке PAP 115 и комбинацией pH и аминов (FemCard), но другие тесты на BV клинически бесполезны. Вагинальные посевы, в частности на г.vaginalis , особенно вводят в заблуждение, поскольку у 40% женщин без БВ во влагалище находится G. vaginalis . 116

    Осложнения

    Ожидается, что высокая концентрация потенциально вирулентных анаэробных бактерий вызовет другие инфекции. БВ был связан с множеством инфекций верхних отделов половых путей (таблица 4).

    ТАБЛИЦА 4. Осложнения, связанные с бактериальным вагинозом

    –2,0

    030002

    4

    Осложнение

    Приблизительный относительный риск

    9112 9113 9113 9113 9113 9113 9113 9113 9113 9113 9113 9113 9113 9113 9113 9113 9128

    Инфекция околоплодных вод

    2,0–2,5

    Хориоамнионит

    3

    Послеродовой эндометрит

    После кесарева сечения

    6

    После родов через естественные родовые пути

    9132

    45

    Воспалительное заболевание тазовых органов после аборта

    2,5–3

    ДОСРОЧНАЯ ДОСТАВКА.

    BV был обнаружен у 12–22% из примерно 16 000 беременных женщин, которые участвовали в исследованиях, в которых изучалась связь BV с преждевременными родами. 92 Когорты беременных пациенток происходили из разных социально-экономических слоев и стран. BV был более распространен, чем комбинированные числа для гонорейных, хламидийных инфекций и инфекций мочевыводящих путей в исследовании, которое изучалось для каждого из них, и в этой популяции относительный риск BV для преждевременных родов составлял 6%. 14 BV неизменно был связан с преждевременными родами и низкой массой тела при рождении в этих исследованиях. 92 BV присутствовал в 25–35% группе, родившей преждевременно, по сравнению с 10–18% среди тех, кто родил в срок, а относительный риск преждевременных родов для группы BV составлял от 1,5 до 2,3 по сравнению с таковыми. без БВ. 92

    В самом крупном из этих исследований, в котором участвовало более 11 000 пациентов, также изучались потенциальные искажающие переменные.После учета демографических факторов, курения, предшествующих преждевременных родов и восстановления других потенциальных патогенных микробов из влагалища и шейки матки, БВ оставался связанным с преждевременными родами (ОР = 1,6, 95% ДИ, 1,2–2,0). 14 У женщин с BV, получавших антибиотики, эффективные против BV, частота преждевременных родов была такой же, как и у женщин без BV, что позволяет предположить, что лечение BV может уменьшить преждевременные роды.

    BV может вызвать инфекцию околоплодных вод, если она причинно связана с преждевременными родами.БВ ассоциируется с повышенным риском инфицирования околоплодных вод, хориоамнионита 117 , 118 и гистологического хориоамнионита. 118 Бактерии, ассоциированные с БВ, составляют около половины изолятов из околоплодных вод женщин, родившихся при преждевременных родах с неповрежденными плодными оболочками. 119 В срок клиническая инфекция околоплодных вод с лихорадкой во время родов встречалась в 1,5 раза чаще у пациентов с БВ, чем без нее. 120

    В двух рандомизированных двойных слепых испытаниях лечения женщин с высоким риском преждевременных родов лечение БВ пероральным метронидазолом привело к снижению частоты преждевременных родов. 121 , 122 Напротив, лечение женщин с низким риском преждевременных родов не привело к сокращению преждевременных родов, 123 , 124 и необходимы дополнительные исследования.

    ПОСЛЕДНИЙ ЭНДОМЕТРИТ.

    Относительный риск послеродового эндометрита (PPE) после кесарева сечения среди лиц с BV был в 5,8 раз выше, чем у лиц с доминирующей флорой Lactobacillus . 125 Этот высокий риск СИЗ возник после контроля продолжительности разрыва мембраны (которая была скорректирована с учетом продолжительности родов), что позволяет предположить, что БВ был связан с СИЗ независимо от наиболее важного акушерского фактора для такой инфекции.Около 60% бактерий, выделенных из эндометрия женщин с СИЗ, являются бактериями, ассоциированными с BV. 126 BV также ассоциируется с двукратным повышением риска СИЗ после родов через естественные родовые пути. 127

    ЦЕЛЛЮЛИТ ВЛАГИНАЛЬНОЙ МАНЖЕТЫ.

    Целлюлит влагалищной манжеты возникает, когда вагинальные бактерии заражают операционное поле и инфицируют заполненное сывороткой пространство между вагинальной манжетой и брюшиной после гистерэктомии. Целлюлит влагалища после абдоминальной гистерэктомии встречается примерно в четыре раза чаще среди пациентов с БВ, чем у пациентов с нормальной -доминантной флорой Lactobacillus . 11 , 128 Приписываемый риск БВ в развитии целлюлита манжеты составил 69% в одном исследовании. 11 Рандомизированное исследование лечения пациентов с БВ, перенесших гистерэктомию, не проводилось, но однократная доза 2 г тинидазола за 12 часов до операции значительно снизила послеоперационный целлюлит манжеты после вагинальной 129 и абдоминальной гистерэктомии. 130 В практических целях перед операцией женщины должны пройти обследование и лечение на БВ.

    ПОСТАБОРТНОЕ ВОСПАЛИТЕЛЬНОЕ ЗАБОЛЕВАНИЕ ТАЗА.

    Спонтанное воспалительное заболевание органов малого таза (PID) часто вызывается гонореей или хламидийными инфекциями, а PID после искусственного аборта связано с Chlamydia. 131 Однако ВЗОМТ после искусственного прерывания беременности также связано с БВ. Постабортный ВЗОМТ значительно чаще встречался у пациентов с БВ, чем без него (ОР = 2,3). 10 В последующем исследовании пациенты, перенесшие искусственный аборт с БВ, были приглашены для участия в рандомизированном двойном слепом исследовании плацебо или метронидазола.У пациентов, получавших плацебо, частота постабортных ВЗОМТ была в три раза выше, чем у пациентов, получавших метронидазол, 132 , что предполагает, что лечение следует проводить всем пациентам с БВ, перенесшим искусственный аборт.

    СПОНТАННАЯ ВОСПАЛИТЕЛЬНАЯ БОЛЕЗНЬ ТОЗА.

    Роль BV в спонтанном PID менее определена. Случайно выбранные пациенты клиники ЗППП с БВ имели более высокую вероятность, чем пациенты без БВ, иметь болезненность придатков даже после контроля гонорейных и хламидийных инфекций, что позволяет предположить, что БВ может быть связан с ВЗОМТ. 20 Среди женщин, отобранных с подозрением на ВЗОМТ, эндометрит плазматических клеток присутствовал у 65%. 133 В этом исследовании эндометрит был значительно связан с извлечением N. gonorrhoeae и C. trachomatis из эндометрия и с извлечением анаэробных грамотрицательных палочек из эндометрия (OR = 2,6). 133 Поскольку один только BV не был связан с эндометритом, он может не быть фактором риска развития эндометрита независимо от гонорейных и хламидийных инфекций, но наличие анаэробных грамотрицательных палочек в эндометрии может вызвать эндометрит плазматических клеток независимо от двух других Бактерии, передающиеся половым путем.Многие бактерии, извлеченные из трубок и особенно из абсцессов у женщин с ВЗОМТ, связаны с БВ. 134 Однако частота симптоматических ВЗОМТ среди женщин с БВ может быть низкой по сравнению с частотой приступов ВЗОМТ у женщин с гонорейными или хламидийными инфекциями.

    BV может быть фактором эндометрита плазматических клеток. Среди женщин с выделениями из влагалища или тазовой болью в клинике ЗППП плазматический эндометрит присутствовал у 45% женщин с БВ по сравнению с 5% в контрольной группе без БВ. 135 В другом отчете плазматический эндометрит присутствовал у 40% женщин с одним только BV (без гонорейных или хламидийных инфекций) по сравнению с 13% женщин из контрольной группы без инфекции. 136 Эти объединенные данные не являются убедительным аргументом в пользу лечения БВ у бессимптомных небеременных женщин для предотвращения спонтанных ВЗОМТ.

    ИНФЕКЦИЯ ВИРУСА ИММУНОДЕФИЦИТА ЧЕЛОВЕКА.

    In vitro , H 2 O 2 -продуцирующая Lactobacillus , особенно вместе с галогенид-ионом и пероксидазой, может убивать ВИЧ. 9 Женщины с БВ обычно не имеют H 2 O 2 -продуцирующих Lactobacillus 23 и, следовательно, могут подвергаться повышенному риску заражения ВИЧ в случае контакта. Два поперечных исследования выявили более высокий уровень БВ среди женщин с ВИЧ-инфекцией, чем у женщин с преобладающей флорой, содержащей Lactobacillus . 91 , 137 В продольном исследовании женщин Малави БВ, диагностированный во время беременности, был связан со значительным увеличением ранее сероконверсии ВИЧ (OR = 3.7) и после родов (OR = 3,5). 15 BV слабо связано с уровнем сероконверсии ВИЧ среди секс-работников в Кении. 138 Эти данные указывают на то, что у женщин с БВ может быть более высокий уровень развития ВИЧ-инфекции. Планируются испытания лечения BV, чтобы определить, влияет ли лечение BV на скорость заражения ВИЧ. За этими исследованиями следует внимательно следить, поскольку они могут привести к лечению бессимптомных небеременных женщин с БВ.

    Терапия

    ТЕРАПИЯ ПЕРВОГО ЛИНИЯ.

    Несколько схем лечения противомикробными препаратами обеспечивают эффективность от 85% до 95%. Эти схемы включают метронидазол (500 мг), принимаемый перорально два раза в день в течение 7 дней, 98 , 139 2% крем клиндамицина ежемесячно в течение 7 дней, 140 и 0,75% гель метронидазола, вводимый дважды в день в течение 5 дней 141 (таблица 5). Местные схемы связаны с меньшим количеством побочных эффектов, потому что доза антибиотика низкая по сравнению с пероральной терапией.

    ТАБЛИЦА 5. Лечение бактериального вагиноза

    Лечение

    Схема

    9405

    , 2 раза в день

    2% крем клиндамицин в.ч. в течение 7 дней

    0.75% Метронидазол, гель 2 раза в день в течение 5 дней

    Альтернатива

    Метронидазол, 2 г в разовой дозе

    Клиндамицин 740

    перорально 3 раза в день

    ДРУГИЕ ВЫБОРЫ.

    Две схемы, которые обеспечивают уровень излечения от 80% до 85%, включают метронидазол (2 г), принимаемый перорально за один раз, 98 , 139 300 мг клиндамицина, принимаемый перорально в течение 7 дней, 142 и амоксициллин / клавулановая кислота (500 мг) три раза в день в течение 7 дней. 143

    Схемы третьего ряда имеют минимальную эффективность при лечении БВ. Ампициллин или амоксициллин (500 мг), принимаемые перорально три-четыре раза в день, излечивают БВ только у 30-45% пациентов. 143 , 144 Ципрофлоксацин (500 мг), принимаемый перорально три раза в день 145 и тройной сульфатный вагинальный крем 116 , используемый два раза в день в течение 7 дней, обеспечивают процент излечения только от 20% до 50%. Как правило, эти схемы не следует использовать.

    Некоторые препараты оказались неэффективными при лечении БВ.Эти агенты включают эритромицин, тетрациклин 147 , доксициклин 94 и несколько интравагинальных препаратов, включая повидон-йод, гель уксусной кислоты 148 и лактобациллы . 149

    МУЖСКАЯ ТЕРАПИЯ.

    BV часто подозревали в том, что он передается половым путем, хотя прямых доказательств не существует. Поскольку рецидивирующая инфекция является обычным явлением, некоторые исследователи рекомендуют лечение партнеров-мужчин. Существует четыре рандомизированных исследования, в которых терапия метронидазолом мужчин-половых партнеров женщин с БВ не влияла на последующие рецидивы БВ у женщин. 98 , 99 , 100 Лечение партнера-мужчины не должно проводиться при обычном лечении БВ.

    ЧАСТО РЕАЛЬНЫЙ БАКТЕРИАЛЬНЫЙ ВАГИНОЗ.

    Показатели излечения высоки при использовании препаратов первого или второго выбора, но небольшая группа женщин страдает быстрой или повторяющейся рецидивирующей инфекцией. Причина рецидива инфекции не выяснена, но одна из возможных причин — резистентные бактерии. Пациентов с быстро рецидивирующей инфекцией следует эмпирически перевести на альтернативный противомикробный препарат, например, с метронидазола на клиндамицин.Пациентам, у которых заболевание рецидивирует после смены противомикробных препаратов, я даю интравагинальный препарат метронидазола или клиндамицина в течение 3 недель с последующей интравагинальной терапией каждые 3 дня в течение дополнительных 3 недель. Последняя часть схемы предназначена для подавления бактерий, вызывающих BV, в то же время позволяя Lactobacillus повторно колонизироваться во влагалище. Некоторым пациентам, у которых развиваются рецидивы, связанные с половым актом, полезно принимать таблетку метронидазола при каждом эпизоде ​​полового акта.

    АТРОФИЧЕСКИЙ ВАГИНИТ

    Атрофический вагинит — это симптоматическое воспалительное состояние влагалища, вызванное дефицитом эстрогена вагинальным эпителием. Симптомы включают вагинальное кровотечение и болезненность, внешнюю дизурию, зуд и диспареунию. Диагноз атрофического вагинита можно подтвердить, обнаружив в мазке из влагалища гладкую бледно-розовую поверхность влагалища без морщин и преобладание парабазальных клеток. Может существовать умеренное раздражение вульвы. Выделение обычно незначительное, с pH выше 5.Микроскопия обычно выявляет отсутствие микроорганизмов, включая лактобациллы, хотя бактериология атрофического вагинита еще не определена. Следует исключить новообразования, инородные тела и другие инфекционные причины симптомов. Атрофический вагинит лечится эстрогенами местного действия, которые утолщают вагинальный эпителий и уменьшают симптомы. Крем с эстрогеном можно вводить во влагалище один раз в день в течение 2 недель, а затем через день в течение 2 недель. У большинства пациентов терапию эстрогенами можно полностью прекратить без повторения симптомов.Поскольку вагинальные эстрогены легко всасываются, длительное вагинальное применение эстрогенов имеет те же недостатки, что и системное применение у женщин в постменопаузе, и для большинства пациентов терапия обычно не требуется после 4 недель.

    ДРУГИЕ ПРИЧИНЫ ВЫДЕЛЕНИЯ ИЗ ВЛАГИНА

    Примерно 5% женщин с вагинитом имеют одно из множества гетерогенных вагинальных состояний. У многих женщин есть DIV, характеризующийся симптомами обильного раздражения, выделений из влагалища, раздражения вульвы и часто боли при половом акте. 17 Физические признаки включают гнойные выделения из влагалища с pH выше 5 и пятна эритемы слизистой оболочки во входе и в верхней трети влагалища. 17 Большое количество лейкоцитов, парабазальных клеток, мелких бактерий и никаких лактобацилл или ключевых клеток не обнаруживается во влажной среде, содержащей физиологический раствор. Причина DIV неизвестна. Пациенты, как правило, имеют высокие концентрации стрептококков или колиформ группы B, выделенных из влагалища, но эти бактерии не могут быть основной причиной инфекции.У женщин с DIV симптомы могут появиться после лечения антибиотиками. Обычно у них нормальный иммунитет, хотя у некоторых есть аутоиммунные заболевания. Я обнаружил, что пациенты ответили на прием 2% клиндамицина 17 или 2% крема цефалексина каждую ночь в течение 4 недель с последующим лечением через ночь в течение еще 4 недель. В качестве альтернативы, суппозитории с гидрокортизоном (Anusol HC) можно чередовать с кремом с антибиотиком интравагинально в течение 4 недель у пациентов с подавленным иммунитетом или аутоиммунным заболеванием.Частота рецидивов умеренно высока при всех режимах.

    Микробиом влагалища женщин репродуктивного возраста

    В организме человека обитают микроорганизмы, обитающие на поверхностях и полостях, подверженных воздействию внешней среды или связанных с ней. Каждый участок тела включает экологические сообщества видов микробов, которые существуют в мутуалистических отношениях с хозяином. Виды присутствующих организмов сильно зависят от преобладающих условий окружающей среды и факторов-хозяев и, следовательно, варьируются от места к месту.Более того, они варьируются от человека к человеку и с течением времени (1). Микробиота влагалища человека, по-видимому, играет ключевую роль в профилактике ряда урогенитальных заболеваний, таких как бактериальный вагиноз, дрожжевые инфекции, инфекции, передаваемые половым путем, инфекции мочевыводящих путей (2–9) и ВИЧ-инфекция (10 , 11). По общему мнению, это связано с продуцирующими молочную кислоту бактериями, в основном Lactobacillus sp., Которые обычно населяют влагалище. Считается, что эти виды играют ключевую защитную роль, снижая pH окружающей среды за счет производства молочной кислоты (12, 13), производя различные бактериостатические и бактерицидные соединения или путем конкурентного исключения (13⇓⇓ – 16).Появление не зависящих от культуры молекулярных подходов, основанных на клонировании и секвенировании генов 16S рРНК, способствовало нашему пониманию микробиоты влагалища путем выявления таксонов, которые не культивировались (17–24). Однако этот метод ограничен высокой стоимостью и низкой производительностью, поэтому обычно анализировалось лишь небольшое количество образцов, а глубина анализа была невелика.

    В этом исследовании мы стремились разработать глубокое и точное понимание состава и экологии микробной экосистемы влагалища у бессимптомных женщин, используя высокопроизводительный метод, основанный на пиросеквенировании генов 16S рРНК со штрих-кодом.Полученные данные являются важной предпосылкой для понимания роли и, в конечном итоге, функции вагинальной микробиоты в снижении риска заражения болезнями и выявления факторов, определяющих восприимчивость к болезням. В частности, мы стремились охарактеризовать вагинальные микробные сообщества в когорте из 396 североамериканских женщин, в равной степени представляющих четыре этнические группы (азиатское, белое, черное и латиноамериканское), и далее преследовать три цели. Первый заключался в том, чтобы установить, существуют ли корреляции между составом сообщества и pH влагалища, поскольку они могут указывать на эффективность сообщества.Второй заключался в изучении того, как видовой состав вагинальных сообществ отражается в шкале Nugent (25), диагностическом факторе, обычно используемом для выявления женщин с бактериальным вагинозом (26). Наконец, третья цель заключалась в выявлении закономерностей в относительной численности различных видов, поскольку они могут отражать антагонистические или кооперативные межвидовые взаимодействия. Результаты и обсуждение , Азиатский ( n = 97) и латиноамериканский ( n = 97).Демографические и другие характеристики женщин приведены в таблице S1. Каждая женщина использовала два мазка для самостоятельного сбора средневлагалищных образцов. Один мазок использовался для оценки микробиоты влагалища на основе критериев Ньюджента, используемых для диагностики бактериального вагиноза (25), а второй был использован в процедурах для определения видового состава и структуры резидентных бактериальных сообществ (27). Последнее было выполнено с помощью филогенетического анализа последовательностей гена 16S рРНК (28).Полногеномную ДНК экстрагировали из каждого мазка, и вариабельные области 1 и 2 (V1 – V2) генов 16S рРНК амплифицировали с помощью ПЦР с использованием универсальных праймеров со штрих-кодом, перечисленных в таблице S2, и пиросеквенировали с использованием прибора Roche 454 FLX. В результате был получен набор данных, состоящий из 897 345 высококачественных последовательностей со средней длиной 240 п.н. и ≈2 200 считываний на образец, которые были классифицированы с использованием наивного байесовского классификатора проекта Ribosomal Database Project (RDP) (29). Таксономическое определение на уровне видов Lactobacillus sp.были выполнены с использованием биоинформатического алгоритма, основанного на комбинации скрытых марковских моделей на уровне видов и кластеризации, как описано в SI Materials and Methods . В целом во влагалищной микробиоте этих женщин было обнаружено 282 таксона (Таблица S3).

    Таксономическое распределение членов вагинального бактериального сообщества и соответствующие метаданные для каждого субъекта показаны в Таблице S4. Глубина охвата каждого сообщества была достаточной для выявления таксонов, составляющих ≈0.1% сообщества. Хотя таксоны, присутствующие на уровне ниже этого, часто называют таксонами с низкой численностью или «редкостью», они редки только в контексте глубины отбора проб. Если бактериальное сообщество влагалища имеет ≈10 8 клеток на миллилитр вагинального секрета, тогда в сообществе присутствует большое количество (10 5 клеток / мл) «редких» членов, тогда как филотипы присутствуют при плотности <10 5 клеток на миллилитр останутся необнаруженными. Эти «редкие» таксоны могут играть важную роль в экологии сообщества, в то время как необнаруженные члены могут составлять «банк семян» видов, численность которых увеличивается в условиях, благоприятствующих их росту.

    Состав и структура бактериального сообщества влагалища.

    Влагалищные бактериальные сообщества были сгруппированы в соответствии с составом сообщества (рис. 1 A и таблица S5), а филотипы были сгруппированы в соответствии с их профилями корреляции, как описано в SI «Материалы и методы » (рис. 1 C ). ). Тепловая карта на рис. 1 показывает результаты, полученные с использованием преобразования log 10 в процентах численности каждого таксона. Он подчеркивает разнообразие, обнаруженное во всех вагинальных бактериальных сообществах, даже в тех, где численность филотипов сильно искажена и преобладает один филотип, и идентифицирует таксоны со сходными профилями корреляции.Для сравнения на рис. S1 показано объединение сообществ в кластеры в соответствии с бактериальным составом и численностью, как описано выше, но основанное только на 25 наиболее распространенных таксонах.

    Рис. 1. Тепловая карта

    журнала 10 -преобразованных пропорций микробных таксонов, обнаруженных в бактериальных сообществах влагалища 394 женщин репродуктивного возраста (цветовой ключ указан в правом нижнем углу). ( A ) Полная кластеризация образцов по сцеплению на основе видового состава и численности вагинальных бактериальных сообществ, которые определяют группы сообществ от I до V.( B ) Показатели Ньюджента и измерения pH для каждой из 394 проб сообщества (цветовой ключ указан над C ). ( C ) Полная кластеризация таксонов по сцеплению на основе профилей коэффициентов корреляции Спирмена, которые были определены как набор коэффициентов корреляции Спирмена, рассчитанных между одним таксоном и всеми другими таксонами ( SI Materials and Methods ). ( D ) Коэффициенты корреляции Спирмена между присутствием таксона и оценкой Ньюджента или pH образца.( E ) Рассчитаны индексы разнообразия Шеннона для 394 вагинальных сообществ (два синглтона были исключены).

    Анализ выявил пять основных групп микробных сообществ (рис. 1 и рис. S1), что напоминает ранее опубликованные исследования микробного разнообразия во влагалище человека (18). Пять групп, обозначенных I, II, III, IV и V, содержали 104, 25, 135, 108 и 21 таксон соответственно (Таблица S3). Наиболее разнообразными сообществами оказались сообщества группы IV, что отразилось на показателях разнообразия сообществ Шеннона (рис.1 и рис. S1). В дополнение к этим группам было два синглтона: в одном доминировали Lactobacillus _3 (99% сообщества), а в другом преобладали представители рода Enterococcus (76% сообщества).

    В отличие от любого другого анатомического участка на теле человека, в большинстве вагинальных сообществ (73%) преобладали один или несколько видов Lactobacillus , которые составляют> 50% всех полученных последовательностей (рис. S1 и таблицы S4 – S6). Сообщества в группе I, произошедшие в 26.2% отобранных женщин преобладали L. crispatus , тогда как в группах II (6,3%), III (34,1%) и V (5,3%) преобладали L. gasseri , L. iners , и L. jensenii соответственно. Как показано в таблице 1, сообщества, принадлежащие к группе I, имеют самый низкий медианный pH (4,0 ± 0,3), тогда как сообщества в группе IV имеют самый высокий медианный pH (5,3 ± 0,6). Интересно, что сообщества, в которых преобладают виды Lactobacillus , отличные от L. crispatus , имеют немного более высокий pH, в диапазоне от 4.4 (группа III) до 5,0 (группа II), что указывает на то, что эти сообщества в целом могут не производить столько молочной кислоты, как группы I, или могут иметь другие буферные возможности.

    Таблица 1.

    pH групп влагалищных сообществ у женщин разных национальностей

    Неравномерное ранжирование видов в этих сообществах оставляет впечатление, что эти сообщества бедны видами, но это может быть не так, потому что существует неизвестное количество видов. «редкие виды. Остальные сообщества, обнаруженные у 27% женщин, образуют большую гетерогенную группу (IV) и характеризуются более высокими пропорциями строго анаэробных бактерий, включая Prevotella , Dialister , Atopobium , Gardnerella , Megasphaera , Peptoniphilus , Sneathia , Eggerthella , Aerococcus , Finegoldia и Mobiluncus .Этот результат согласуется с результатами предыдущих исследований, в которых видовой состав вагинальных сообществ был изучен путем клонирования и секвенирования генов 16S рРНК (17⇓⇓⇓⇓⇓⇓-24). Следует отметить, что хотя сообщества группы IV кажутся разнообразными по сравнению с другими группами (рис. S1), это могло просто отражать большую однородность видов. Решение этой проблемы потребует более интенсивного анализа путем глубокого секвенирования генов 16S рРНК (> 100 000 прочтений) сообществ внутри всех этих групп.

    Хотя в сообществах группы IV не преобладали Lactobacillus sp. , L. iners и L. crispatus были обнаружены в 78,7% и 51,9% сообществ группы IV (Таблица S6) соответственно. Только у четырех субъектов в группе IV не было обнаруживаемых Lactobacillus sp. во влагалище, и в этих сообществах преобладали Prevotella , Sneathia , Megasphaera или Streptococcus . Интересно, что все сообщества содержали членов, которые были отнесены к родам, которые, как известно, продуцируют молочную кислоту, включая Lactobacillus , Megasphaera , Streptococcus и Atopobium .Это предполагает, что важная катаболическая функция, а именно выработка молочной кислоты, может сохраняться среди сообществ, несмотря на различия в видовом составе.

    Путем кластеризации таксонов на основе их корреляционных профилей были выделены три подгруппы сообществ в группе IV (рис. 1 C ). Первый из них определялся взаимодействием семи таксонов, в том числе Cryptobacterium , Gemella , Gardnerella , Aerococcus , Prevotellaceae _1 и Ruminococcaceae _1 и Ruminococcaceae _3 _a и Ruminococcaceae.Второй кластер также определялся сочетанием семи таксонов, включая Sneathia , Megasphaera , Anaerotruncus , Eggerthella , Atopobium , Prevotellaceae _3 и Prevotellaceae _3. Третий кластер отмечен сочетанием пяти таксонов, включая Porphyromonas , Peptoniphilus , Mobiluncus , Dialister и Prevotella . Значение этих ассоциаций неизвестно, но они могут отражать значимые экологические взаимодействия, которые не следует упускать из виду при рассмотрении различий между людьми.

    Несколько неожиданно, Prevotella sp. были обнаружены в 68,5% проб с численностью от нескольких процентов до более 45%. Хотя Prevotella sp. ранее было продемонстрировано, что они являются членами вагинальных сообществ, их распространенность могла быть недооценена, а их роль в сообществе неизвестна. Однако следует отметить, что Prevotella sp. было показано, что они положительно влияют на рост Gardnerella vaginalis и Peptostreptococcus anaerobius , производя ключевые питательные вещества для этих видов, такие как аммиак и аминокислоты.Оба эти вида были связаны с бактериальным вагинозом, отсюда и широкое распространение Prevotella sp. микробиота влагалища может быть фактором, способствующим бактериальному вагинозу (4, 30, 31).

    Основные микробиомы влагалища человека.

    Одна из целей исследований микробиома человека — определить, существует ли основной набор видов микробов, связанных с телами всех людей. Предполагается, что изменения этого «основного микробиома» могут быть коррелированы с изменениями в здоровье человека или риском заболевания.Результаты этого исследования показывают, что для влагалища человека не существует единого ядра микробиома. Вместо этого кажется, что существует несколько основных микробиомов, которые могут быть определены группами сообществ I – V, изображенными на рис. 1. Как отмечалось выше, эти группы можно легко разделить на основе двух критериев: () в составных сообществах преобладают Lactobacillus и ( ii ) конкретные виды присутствующих Lactobacillus . Подавляющее большинство сообществ в группах I, II, III и V имело более одного филотипа молочнокислых бактерий, что предполагает определенную степень функциональной избыточности, но они сильно различались по численности.Например, наблюдалась положительная ассоциация между L. crispatus и Lactobacillales _6, при этом эти таксоны встречаются в 99,1% сообществ в группе I (таблица S6), но последний был гораздо менее многочисленным, чем первый. Аналогичным образом, в группе сообщества III Lactobacillales _2 и Lactobacillales _5 встречались с L. iners в 97,8% и 97% образцов, соответственно (Таблица S6). Хотя мы отметили эти сильные положительные ассоциации, мы не можем объяснить их существование.За исключением видов Lactobacillales, никакие таксоны не обнаруживались вместе в какой-либо группе сообществ с таким постоянством (рис. 1). Хотя основной микробиом не может быть идентифицирован на основе таксонов, обнаруженных в этих сообществах, мы полагаем, что основные функции сохраняются среди сообществ, несмотря на различия в их видовом составе, и что функциональная избыточность будет связана с повышенной надежностью сообщества перед лицом изменений окружающей среды. (32).

    Профили корреляции таксонов и оценок Ньюджента.

    Критерии Ньюджента (25) широко используются для диагностики бактериального вагиноза в соответствии с пропорциями различных клеточных морфологий, наблюдаемых в мазках из влагалища, окрашенных по Граму. Считается, что взвешенная оценка, рассчитанная с использованием этих критериев, отражает относительную численность следующих морфотипов: лактобациллы, Gardnerella vaginalis или Bacteroides (маленькие палочки с грамм-переменной или грамотрицательные палочки) и изогнутые палочки с грамотрицательной переменной. Полученные баллы варьируются от 0 до 10, причем 7 и выше считаются показателями бактериального вагиноза, тогда как 4–6 и 3 или меньше считаются промежуточными и нормальными, соответственно.В этом исследовании сообщества с высокими баллами по Ньюдженту чаще всего ассоциировались с сообществами в группе IV, но также наблюдались в сообществах, принадлежащих к другим группам (рис. 1).

    Поскольку оценки Nugent основаны на взвешенном подсчете различных клеточных морфотипов, мы стремились лучше определить, какие филотипы фактически составляют основу оценок Nugent, и определить типы сообществ, связанных с высокими оценками Nugent. Филотипы, наличие или отсутствие которых оценивается по шкале Ньюджента, были идентифицированы путем вычисления коэффициентов корреляции Пирсона для относительной численности всех филотипов и соответствующих оценок по шкале Ньюджента, которые были отнесены к категориям: низкие (оценки по Ньюдженту 0–3), средние (оценки по Ньюдженту 4– 6) и высокий (Nugent 7–10 баллов).Мы обнаружили, что 119 филотипов положительно или отрицательно коррелировали с оценкой Ньюджента. Из них 59 имели умеренные коэффициенты корреляции в диапазоне 0,0–0,2, которые не были статистически значимыми ( P > 0,001; Рис. S2 C ). Они были исключены в последующих расчетах. Филотипы с очень значимыми корреляциями перечислены в Таблице S7. Коррелограмма, изображающая профили корреляции оставшихся 60 таксонов, которые в значительной степени коррелировали с оценками Ньюджента, показана на рис.2. На этом рисунке филотипы с похожими профилями корреляции были размещены рядом друг с другом с использованием полной иерархической кластеризации по сцеплению, основанной на евклидовых расстояниях между профилями корреляции. Кластеры 3, 4 и 5 включали таксоны с высокими положительными коэффициентами корреляции с оценкой Ньюджента (рис. 2). Из них кластер 3 наиболее коррелировал с высокими баллами по шкале Ньюджента и включал следующие филотипы: Aerococcus , Anaeroglobus , Anaerotruncus , Atopobium , Coriobacteriaceae _32, Coriobacteriaceae _32, Gardnerella , Gemella , Megasphaera , Mobiluncus , Parvimonas , Peptoiphilus , Prevotella , Porphyomonas , Prevotella , Porphyomonas , 3С другой стороны, таксоны, профили корреляции которых были связаны с низкими оценками по шкале Ньюджента (кластеры 1 и 2 на рис.2), включали в основном филотипы Lactobacillus , которые обычно встречались в группах сообществ I, II, III и V. очевидно, что филотипы в кластерах 1 и 2 обычно встречаются вместе, как и совпадение филотипов кластеров 3, 4 и 5. И наоборот, очевидно, что филотипы в кластерах 1 и 2, как правило, не встречаются с филотипами в кластерах 3. –5.Это может отражать антагонистические взаимодействия или конкурентное исключение среди этих групп филотипов.

    Рис. 2.

    Коррелограмма 60 микробных таксонов с отрицательной или положительной корреляцией с оценками Ньюджента. Таксоны микробов с наивысшей отрицательной или положительной корреляцией с оценками Ньюджента были отобраны, как описано в SI Materials and Methods . Коэффициенты корреляции Спирмена между каждым таксоном и всеми другими таксонами были использованы для построения коррелограммы, которая иллюстрирует совместное появление таксонов в сообществах.Также указаны коэффициенты корреляции Спирмена между таксонами и оценками Ньюджента.

    Был проведен сопоставительный анализ на основе попарных взаимодействий между коэффициентами ранговой корреляции Спирмена на основе относительной численности пар филотипов для всех 282 бактериальных филотипов, обнаруженных во влагалищных сообществах, проанализированных в этом исследовании, и результаты показаны на рис. S2 B .

    Различия в микробиомах влагалища этнических групп.

    Когорта исследования состояла примерно из равного числа представителей четырех самоопределенных этнических групп (белых, азиатских, чернокожих и испаноязычных), и это дало возможность оценить взаимосвязь этнического происхождения с составом вагинального бактериального сообщества.Пропорции каждой группы сообщества варьировались среди четырех этнических групп (рис. 3 и рис. S3 A ), и эти различия были статистически значимыми [χ 2 (10) = 36,8, P <0,0001]. Статистически значимых ассоциаций между возрастом и типом сообщества внутри или между этническими группами не наблюдалось.

    Рис. 3.

    Представление групп вагинального бактериального сообщества внутри каждой этнической группы женщин. В скобках указано количество женщин от каждой этнической группы.

    Вагинальные бактериальные сообщества, в которых преобладают виды Lactobacillus (группы I, II, III и V), были обнаружены у 80,2% и 89,7% азиатских и белых женщин соответственно, но только у 59,6% и 61,9% испаноязычных и черные женщины соответственно. Более высокие медианные значения pH у испаноязычных (pH 5,0 ± 0,59) и темнокожих (pH 4,7 ± 1,04) женщин отражают более высокую распространенность сообществ, в которых не доминируют Lactobacillus sp. (кластер IV) в этих двух этнических группах по сравнению с азиатскими (pH 4.4 ± 0,59) и белых (pH 4,2 ± 0,3) женщин (таблица 1). Это важно, потому что появление большого количества лактобацилл и pH <4,5 стали синонимом «здорового». Если принять это за чистую монету, эта общая мудрость предполагает, что, хотя большинство азиатских и белых женщин «здоровы», значительная часть бессимптомных латиноамериканских и чернокожих женщин являются «нездоровыми» - идея, которая кажется неправдоподобной. Также возникает вопрос о том, какие бактериальные сообщества следует считать «нормальными» у латиноамериканских и чернокожих женщин.Мы обнаружили, что группа сообщества IV (разнообразная группа) была перепредставлена ​​среди испаноязычных (34,3%) и чернокожих (38,9%) женщин по сравнению с азиатскими (17,6%) и белыми (9,3%) женщинами (рис. S3 B ). Из этих данных мы заключаем, что бактериальные сообщества влагалища, в которых не доминируют виды Lactobacillus , являются обычными и кажутся нормальными у чернокожих и латиноамериканских женщин. Данные этого исследования согласуются с результатами Zhou et al. (17, 18), которые изучали бактериальные сообщества влагалища белых, черных и японских женщин.Причины этих различий между этническими группами неизвестны, но есть соблазн предположить, что видовой состав вагинальных сообществ может определяться генетически детерминированными различиями между хозяевами. Они могут включать различия в врожденной и адаптивной иммунной системах, составе и количестве вагинальных выделений и лигандов на поверхности эпителиальных клеток, среди прочего. Хотя они могут иметь ключевое значение для формирования вагинальных сообществ, предыдущие исследования также показали, что человеческие привычки и обычаи, включая личную гигиену, методы контроля над рождаемостью и сексуальное поведение, также оказывают сильное влияние (33).

    Небольшое количество различных типов вагинальных сообществ несколько удивительно, учитывая, что эти сообщества, вероятно, собираются независимо после рождения. Повторяемость сборки сообщества предполагает, что хозяин осуществляет строгий отбор в отношении довольно ограниченного числа различных видов бактерий. Это особенно очевидно в ограниченном количестве филотипов Lactobacillus и других бактерий, продуцирующих молочную кислоту, которые широко распространены в этих сообществах. Известность этих популяций и их важная роль в модулировании рН влагалища предполагает, что они могут быть движущими силами в этих сообществах, и их можно рассматривать с точки зрения модели водитель – пассажир Уокера (34, 35).Эта модель постулирует, что экологическая функция присуща «движущим» видам или функциональным группам таких видов, которые выполняют ключевые экологические функции, которые существенно структурируют экосистемы, тогда как «пассажирские» виды — это виды, оказывающие незначительное экологическое воздействие. Исследования, проведенные для выявления влияния этих различных факторов на экологию влагалищного сообщества, будут важны для понимания стабильности, сопротивления и устойчивости сообщества, чтобы можно было разработать стратегии для поддержания здоровья влагалища человека и предотвращения заболеваний.

    Вагинальное общественное пространство.

    Отношения между сообществами были визуализированы с помощью анализа главных компонентов и отображены в трехмерном пространстве. Три основных компонента объясняют 82% дисперсии. Каждая точка на рис. 4 представляет вагинальное сообщество человека. Сообщества, в которых преобладают виды Lactobacillus и представляющие группы I, II, III и V, показаны в каждой из четырех внешних вершин тетраэдра, с сообществами группы IV во внутренней вершине.Сообщества, обнаруженные на ребрах, соединяющих две вершины, представляют собой смеси двух видов Lactobacillus , которые доминируют в сообществах, обнаруженных в соответствующих вершинах, с равной долей каждого вида в средней точке ребра. Мы называем каждое место в этом трехмерном пространстве состоянием сообщества, и можно рассматривать все пространство как представление вероятных альтернативных состояний сообщества или пространства вагинального бактериального сообщества.

    Рис. 4.

    Отношения между бактериальными сообществами влагалища, визуализированные с помощью анализа главных компонентов, в котором относительная численность выражается как пропорции всего сообщества и отображается в трехмерном пространстве.Сообщества, в которых доминируют виды Lactobacillus и представляющие группы сообществ I, II, III и V, показаны в каждой из четырех внешних вершин тетраэдра, с сообществами группы IV во внутренней вершине и показаны на вставке . ( A ) Каждая точка соответствует одному предмету и окрашена в соответствии с пропорциями филотипов в каждом сообществе. ( B ) pH каждого влагалищного сообщества, показанного в A . ( C ) Категория оценки Nugent каждого вагинального сообщества, показанная в A .

    Поперечный дизайн этого исследования с использованием только одной выборки от каждого субъекта не позволяет узнать, меняется ли расположение этих сообществ в пространстве влагалищного сообщества с течением времени. Тем не менее, на данном этапе мы можем предложить четыре различные концептуальные модели для изменения состава сообщества с течением времени. Первая — это «гипотеза динамического равновесия», в которой состав сообщества относительно неизменен во времени и существует в едином динамическом равновесии. Вторая «гипотеза о пространстве сообщества» противоположна первой, и каждое сообщество может занимать и занимает любое положение в пространстве сообщества с течением времени и на протяжении всей жизни женщины.Постулируется, что эти изменения происходят в ответ на гормональные циклы, индивидуальные привычки и обычаи, изменения в диете или некоторые другие экологические факторы. Третья модель — это «гипотеза альтернативных состояний равновесия», в которой сообщество женщин может меняться с течением времени, но количество альтернативных состояний ограничено и определяется неизвестными факторами. Четвертая возможность — это «гипотеза устойчивости сообщества», согласно которой сообщество обычно проживает в одной области пространства. В этом сценарии состав и структура вагинального сообщества могут измениться до переходного состояния в ответ на нарушение, но сопротивление и устойчивость сообщества определяют степень и продолжительность изменения, тогда как гомеостатические механизмы возвращают сообщества в их «основное состояние». ».Мы ожидаем, что ни одна гипотеза не объяснит динамику всех сообществ. Каждая из этих гипотез может быть формально оценена только после того, как будут доступны данные временных рядов о динамике вагинального микробного сообщества вместе с обширными метаданными о поведении, привычках и практиках субъекта, истории болезни и другой информации. В настоящее время краткосрочная временная динамика вагинальных сообществ неизвестна, поскольку не проводилось исследований, в которых бы часто отбирались образцы у одних и тех же людей, а вариации в составе сообщества оценивались с течением времени с использованием методов, не зависящих от культивирования.

    Показатели pH и Ньюджента для каждого сообщества отображены в трехмерном пространстве сообщества на рис. 4 B и C . Цифры (и рис. S4) показывают сильную корреляцию между высоким pH и высокими показателями Nugent. Как представлено в Таблице 1 и изображено здесь, самые низкие значения pH были связаны с состояниями сообщества, в которых доминировали L. iners и L. crispatus , а самые высокие значения pH были связаны с состояниями сообщества, в которых не преобладали виды Lactobacillus . .Показатели Nugent и значения pH увеличивались по мере увеличения доли Lactobacillus sp. выросла. Наиболее отчетливо это наблюдалось в сообществах, в которых численность L. iners уменьшалась в пропорции . Интересно, что повышенный pH и высокие баллы по шкале Ньюджента наблюдались в некоторых сообществах, в которых высока доля видов Lactobacillus (также показанных на рис.1), что позволяет предположить, что эти показатели нельзя предсказать с абсолютной уверенностью только на основе доли . Lactobacillus в сообществе.Очевидно, что необходимы дополнительные исследования, чтобы понять различные факторы, влияющие на pH влагалища.

    По аналогии с другими биологическими сообществами, разумно предположить, что вагинальные микробные сообщества существуют в состоянии динамического равновесия и что существуют гомеостатические механизмы, обеспечивающие устойчивость. Учитывая принципиальные различия в видовом составе этих сообществ, можно предположить, что они будут различаться по количеству и силе межвидовых взаимодействий.Это, в свою очередь, повлияет на относительную устойчивость и устойчивость каждого типа сообщества к нарушениям. Если это так, то инвазивные виды, включая как условно-патогенные, так и явные патогены, с большей вероятностью закрепятся в сообществах, которые демонстрируют низкую стабильность, и обратное также будет верным (36). Это имеет прямое значение для оценки восприимчивости к инфекционным заболеваниям. Важно отметить, что это также предполагает, что различия в составе бактериального сообщества влагалища следует принимать во внимание при оценке риска заболевания.Это станет первым шагом к персонализированной медицине репродуктивного здоровья женщин, в которой различия между вагинальными микробиомами отдельных людей будут приниматься во внимание при оценке риска, а также для диагностики и лечения заболеваний.

    Материалы и методы

    Сбор образцов и план исследования.

    Женщины были набраны в трех клинических центрах: две в Балтиморе, в Медицинской школе Университета Мэриленда, и одна в Атланте, в Университете Эмори.Набор проводился в период с июня 2008 года по январь 2009 года. Все женщины не были беременны, репродуктивного возраста от 12 до 45 лет (в среднем 30,6 ± 7,32 года), с регулярными менструациями (менструальный цикл от 25 до 35 дней), с анамнезом половой жизни и не принимал никаких антибиотиков или антимикотических препаратов в течение последних 30 дней. Женщин просили воздерживаться от половой жизни за 48 часов до посещения. Женщины были исключены из исследования, если они использовали спринцевание, вагинальные препараты или суппозитории, женские спреи, салфетки для половых органов или контрацептивные спермициды или сообщали о выделениях из влагалища в течение последних 48 часов.Кроме того, были исключены женщины, у которых были менструации или в настоящее время использовались противозачаточные средства, которые непосредственно вводятся в слизистую оболочку влагалища, такие как НоваРинг. После получения информированного согласия каждый участник заполнил анкету о сексуальном здоровье и поведении.

    Участники получили два самостоятельно взятых тампона с использованием системы Elution-swab (Copan). Первые тампоны хранили в 1 мл транспортной среды Эмиса (Copan) и замораживали в вертикальном положении на сухом льду до транспортировки в лабораторию, где они хранили при -80 ° C.Вторые тампоны были накатаны медсестрой на предметное стекло микроскопа, которое было высушено на воздухе, окрашено по грамму, а затем оценено в баллах с использованием критериев Ньюджента (4). Затем второй тампон хранили в 1 мл транспортной среды Эмиса и замораживали в вертикальном положении на сухом льду до транспортировки в лабораторию, где они хранились при -80 ° C. Два техника независимо оценили слайды, окрашенные по грамму, а третий техник оценил расхождения. Те, кто набрали 0–3 балла, имели низкий балл, тогда как пациенты с баллами 4–6 и 7–10 были отнесены к средней и высокой соответственно.

    pH влагалища измеряли с помощью перчатки VpH (Inverness Medical) и оценивали медсестрой в соответствии с инструкциями производителя по шкале от 4,0 до 7,7.

    Институциональные наблюдательные советы Медицинской школы Университета Эмори, Мемориальной больницы Грейди и Медицинской школы Университета Мэриленда одобрили протокол. При проведении клинических исследований соблюдались рекомендации университетов. Исследование зарегистрировано в клинических исследованиях.gov под идентификатором NCT00576797.

    Выделение полногеномной ДНК из вагинальных мазков.

    Тампоны перед анализом размораживали на льду и интенсивно встряхивали в течение 5 мин для ресуспендирования клеток. Аликвоту 0,5 мл переносили в стерильную пробирку на 2,0 мл и хранили на льду. Лизис клеток инициировали добавлением 50 мкл лизозима (10 мг / мл), 6 мкл мутанолизина (25000 Ед / мл; Sigma-Aldrich), 3 мкл лизостафина (4000 Ед / мл в ацетате натрия; Sigma-Aldrich), и 41 мкл буфера TE50 (10 мМ Tris · HCL и 50 мМ EDTA, pH 8.0). После 1-часовой инкубации при 37 ° C клетки разрушали взбиванием шариков, которое выполняли с обесцвеченными и промытыми шариками диоксида циркония / диоксида кремния диаметром 0,1 мм (BioSpec Products) в течение 1 мин при комнатной температуре, с 36 колебаниями на второй (2100 об / мин) в Mini-Beadbeater-96 (BioSpec Products). Полученный неочищенный лизат обрабатывали с использованием мини-набора QIAamp DNA (Qiagen) в соответствии с рекомендациями производителя для сырых лизатов. Образцы элюировали 2 × 200 мкл буфера AE (10 мМ Tris-Cl, 0.5 мМ ЭДТА; pH 9,0) в отдельные пробирки. Концентрации ДНК в образцах измеряли с использованием набора для анализа дцДНК Quant-iT PicoGreen от Molecular Probes (Invitrogen).

    Пиросеквенирование ампликонов гена 16S рРНК со штрих-кодом.

    Универсальные праймеры 27F и 338R использовали для ПЦР-амплификации гипервариабельных участков V1 – V2 генов 16S рРНК (3). Праймер 338R включал уникальный тег последовательности для штрих-кодирования каждого образца. Праймеры были следующими: 27F-5′-GCCTTGCCAGCCCGCTCAGTC AGAGTTTGATCCTGGCTCAG -3 ‘и 338R-5’-GCCTCCCTCGCGCCATCAGNNNNNNNNNCAT GCTGCCTCCCGTAGGAGT последовательности праймеров 45804, подчеркнутые последовательностями GCTGCCTCCCGTAGGAGT, а последовательность GCTGCCTCCCGTAGGAGT — последовательность 338R соответственно, жирными буквами обозначены универсальные праймеры 16S рРНК 27F и 338R.Штрих-код из 8 пар оснований в праймере 338R обозначен 8 Ns. Используя 96 штрих-кодированных праймеров 338R (таблица S2), области V1 – V2 генов 16S рРНК амплифицировали в 96-луночных микротитрационных планшетах с использованием ДНК-полимеразы AmpliTaq Gold (Applied Biosystems) и 50 нг матричной ДНК в общем объеме реакции 50 мкл. Реакции проводили в терморегуляторе PTC-100 (MJ Research) с использованием следующих параметров цикла: 5 минут денатурации при 95 ° C, затем 20 циклов по 30 с при 95 ° C (денатурация), 30 с при 56 ° C. (отжиг) и 90 с при 72 ° C (удлинение) с окончательным удлинением при 72 ° C в течение 7 мин.Отрицательные контроли без матрицы были включены для каждой пары праймеров со штрих-кодом. Наличие ампликонов подтверждали гель-электрофорезом на 2% агарозном геле и окрашиванием SYBRGreen. Количество продуктов ПЦР определяли с использованием системы количественного анализа GelDoc (BioRad) и анализа дцДНК Quant-iT PicoGreen. Эквимолярные количества (100 нг) ампликонов ПЦР смешивали в одной пробирке. Праймеры для амплификации и реакционный буфер удаляли из каждого образца с помощью набора AMPure Kit (Agencourt). Очищенные смеси ампликонов секвенировали пиросеквенированием 454 FLX с использованием праймера A 454 Life Sciences Центром ресурсов геномики Института геномных наук Медицинской школы Университета Мэриленда с использованием протоколов, рекомендованных производителем с поправками, внесенными Центром.

    Группирование чтения последовательности.

    Последовательности были объединены по образцам с использованием последовательностей штрих-кода, специфичных для образца, и обрезаны путем удаления последовательностей штрих-кода и праймеров.