13Июн

Удаление спаек кишечника: Страница не найдена (404 Not Found)

Содержание

Удаление спаек кишечника — цена лапароскопическую операцию удаления спаек кишечника от клиники hirurgia.kiev.ua

Часто после оперирования внутренних органов в брюшной полости образуются спайки. Они представляют собой своеобразные пленочные соединения. Рост спаек – процесс патологический.

Одним из современных способов лечения этой болезни является лапароскопический адгезиолизис — рассечение соединительных новообразований без вскрытия брюшины.

Подготовка к операции и диагностика пациента

Лапароскопия относится к форме операций, которые проводятся после детального обследования больного. Она не возможна без следующих важных данных о пациенте:

  • общего анализа крови, определения ее группы и резус-фактора;
  • анализа мочи;
  • флюорографии;
  • кардиограммы;
  • разрешения терапевта на операцию и пр.

Качественное оперирование спаечной болезни может быть осуществлено только при правильном определении места ввода хирургических инструментов. Дооперационная диагностика — очень ответственный этап лапароскопии. Его проводят с применением УЗИ, допплерографии, пневмоперитонеума (заполнения брюшины газом). Это позволяет дать четкую картину:

  • распространения спаечных образований;
  • места непроходимости кишечника;
  • изменений в брюшине и ЖКТ на макроскопическом уровне.

На основе всех данных врач выбирает оптимальную лечебную тактику. Если спаечный процесс имеет ограниченный характер и неплотные спайки, то лапароскопическое вмешательство наиболее эффективно и не повредит органы.

Инструменты и оборудование

Одним из основных инструментов операции является эндоскоп особой конструкции. Он состоит из трубки диаметром 5-10 мм с подвижной системой линз, оптического кабеля и видеокамеры внутри, изображение от которой передается на внешний монитор. Главная функция прибора – диагностика и визуализация операции. К рабочим инструментам при операции относятся троакары, тонкие и длинные манипуляторы, зажимы, скальпели, петли, ножницы, клипперы и др.

Схема процедуры и видео операции

Лапароскопия проводится под общим наркозом. Чтобы создать оперативное пространство, вначале брюшную полость надувают углекислым газом. Образуется купол между стенкой брюшины и внутренними органами. После этого по данным диагностики брюшина прокалывается в определенных местах и туда устанавливается лапароскоп и 2-3 вспомогательные трубки. Обнаруженные спайки пересекают такими методами:

  1. Лазерным — с использованием энергии светового луча.
  2. Электрическим, рабочим инструментом которого является электронож.
  3. Аквадиссекционным, когда спайки режутся струей воды.

После основных манипуляций, перед тем, как удалить инструменты, в брюшную полость подают препарат, предотвращающий повторное образование спаек. С этой же целью органы оборачивают тонкой саморассасывающейся полимерной пленкой.

Для более глубокого понимания техники проведения лапароскопии спаечной болезни рекомендуем посмотреть видео операции, проведенной в нашей клинике в Киеве:

 

Достоинства и противопоказания метода

Опыт лапароскопических операций при спаечной болезни показал, что они во многих случаях лучше, чем открытые операции. Кроме косметических преимуществ, лапароскопия имеет и другие плюсы:

  • менее острый постоперационный болевой синдром;
  • более короткий восстановительный период;
  • низкий травматизм тканей.

После лапароскопии нет необходимости в частом переливании крови. Метод редко провоцирует грыжи, не вызывает инфекцию ран и серьезные осложнения. От такой операции стоит отказаться в случаях, когда спайками поражена значительная область брюшины, имеются кишечные свищи или перитонит. К лапароскопичес­кому адгезиолизису стоит осторожно относиться пациентам, у которых больное сердце, гипертония, слабая перистальтика, есть чувство беспокойства и непереносимость пневмоперитонеума.

Период восстановления

У больных после рассечения спаек период реабилитации длится недолго. Схема восстановления в течение двух недель выглядит следующим образом. Первые сутки пациентам дают два раза прозерин, колют три раза анальгетики и делают эвакуацию желудка.

На второй день разрешают вставать, проводят небольшой массаж живота и назначают клизмы, стимулирующие перистальтику кишечника. Чтобы не ослабла моторная функция ЖКТ, с третьего по восьмой день при отсутствии застойных процессов и рвоты рекомендуется жидкая еда. Принимать ее следует малыми дозами.

Выписывают из нашей клиники в Киеве на 10-14 сутки. Первые месяцы стоит исключить активные физические нагрузки, работы по дому, посещение бани. При душевых процедурах до снятия швов необходимо использовать водозащитные повязки. Питание должно быть умеренным, без жирной, копченой, острой еды. Предпочтительна пища с преобладанием кисломолочной продукции. Если придерживаться такого режима, то можно быстро поправиться и вернуться к полноценной жизни.

Профилактика спаечного процесса после операции в трубах, в придатках, в яичниках

Единого мнения о патогенезе и профилактике спаечного процесса в органах малого таза до сих пор

не выработано. Трудность заключается в том, что само образование спаек является нормальной реакцией организма на распространение воспалительного процесса, особенно при хроническом воспалении или травматизации. Спайки предохраняют окружающие органы от распространения патологии. При этом нарушается естественная анатомия. Организм как бы выбирает меньшее из двух зол. Поэтому основное направление профилактики должно заключаться в предотвращении заболеваний, вызывающих спаечные процессы. К таким заболеваниям относятся все воспалительные и патологические процессы в органах малого таза: эндометриоз, воспаление яичников, маточных труб (сальпингит, гидросальпинкс), травматизация в результате выкидышей, полостных операций. Высок процент последующего образования спаек при негинекологических операциях, например, после удаления аппендикса, лапаротомии. Спаечный процесс в области органов репродуктивной системы женщины приводит к бесплодию, в области кишечника – к запорам, болям, вероятности защемления кишечника при нагрузках.

Для тех, кто перенес операцию, отдельно стоит выделить необходимость профилактики спаечного процесса после лапароскопии и дать некоторые рекомендации.

Профилактика спаечного процесса после операций

Любая травматизация брюшины (в том числе неизбежная травматизация хирургическими инструментами во время операции) ведет к образованию спаек. Чтобы препятствовать этому процессу, необходимо после операции проводить медикаментозное лечение. Во-первых, это

прием антибиотиков и противовоспалительных препаратов, которые купируют распространение инфекций.

Послеоперационные спайки образуются по нескольким причинам: травматизация тканей, недостаточное кровоснабжение, внутреннее кровотечение. Даже установка положенного дренажа после операции не может полностью предотвратить кровоизлияние в брюшную полость. В то же время, в процессе операции на месте манипуляций могут оставаться частички шовного материала, тампонов, талька с перчаток. Сами по себе они не токсичны, но могут вызывать так называемые «точки кристаллизации», т.е. места образования спаек.

В качестве профилактики после операций в брюшную полость вводят барьерные жидкости, которые предотвращают «слипание» органов с брюшиной. Помимо этого, используют чисто механический барьерный метод – окутывают маточные трубы и яичники полимерной пленкой, которая со временем самопроизвольно рассасывается.

Чтобы уменьшить вероятность образования спаек, после операций применяют фибринолитические препараты. Они препятствуют отложению фибрина – белка, который является основным составным элементом при образовании спаек.

Все вышеприведенные методы являются необходимыми для профилактики спаечного процесса. Но, вместе с тем, не стоит забывать, что главное – устранить причину исходного заболевания. Если же патология является следствием полостных операций, то нужно понимать, что каждая последующая операция увеличивает количество и плотность спаек, инициирует все новые очаги их образования.

Специалисты нашей клиники помогут диагностировать и вылечить спаечный процесс.
Позвоните консультанту +7 (495) 211-71-78, 979-00-00 или задайте вопрос доктору.


Хирургическое лечение спаечной непроходимости кишечника у подростков с использованием струйного гидроскальпеля

PAEDIATRIC SURGERY.2016.3-4(52-53):51-57; doi 10.15574/PS.2016.52-53.51 

Хирургическое лечение спаечной непроходимости кишечника у подростков с использованием струйного гидроскальпеля 

Скиба В. В., Рыбальченко В. Ф., Иванько А. В., Деміденко Ю. Г., Бадах В. М., Бочаров В. П.
Национальный медицинский университет имени А.А. Богомольца, г. Киев, Украина
Национальная медицинская академия последипломного образования имени П.Л. Шупика, г. Киев, Украина
Национальный авиационный университет, г. Киев, Украина
Киевский медицинский университет УАНМ, Украина
Киевская городская клиническая больница №1, Украина


Цель – улучшение результата хирургического лечения непроходимости кишечника по причине спаечного процесса у подростков с использованием струйного гидроскальпеля при разделении спаечного процесса.

Пациенты и методы. В хирургических отделениях Киевской городской клинической больницы №1 с 2009 г. по 2016 г. находились на лечении 16 подростков в возрасте 17–18 лет. Больных мужского пола было 9 (56,25%), женского – 7 (43,75%). При госпитализации проводилось общеклиническое исследование крови и мочи, рентгенологическое и УЗ-исследование органов брюшной полости.

Результаты. Причинами развития спаечного процесса были: перенесенные аппендэктомии в анамнезе, из которых у лиц мужского пола – 9 (56,25%), женского – 5 (31,25%). У двух подростков (12,5%) женского пола причинами первой операции были гинекологические болезни. Срок госпитализации: в течение первых суток госпитализированы 11 (68,75%), на вторые – 3 (18,75%), на третьи – 2 (12,5%) больных. При госпитализации общее состояние расценено как тяжелое у 12 (75,0%) больных, а крайне тяжелое – у 4 (25,0%), с признаками органной недостаточности – олигурия. Анализ клинической картины показал, что синдром рвоты имели все 16 (100,0%) больных, из которых у 11 (68,75%) рвота была невыносимой и с икотой. Болевой синдром имели 12 (75,0%) больных, из которых у 8 (50,0%) были схваткообразные, а у 4 (25,0%) – постоянные боли. Болевой синдром отсутствовал у 4 (25,0%) пациентов, но имелось ощущение тяжести в эпигастральной области. Асимметрия передней брюшной стенки установлена у 14 (87,5%) пациентов, из которых асимметрия правых и левых отделов – у 8 (50,0%), а верхних и нижних – у 6 (37,5%). У 2 (12,5%) пациентов брюшная полость не была вздута, но имелся выраженный абдоминальный болевой синдром схваткообразного характера. Рентгенологическое исследование показало, что уровни жидкости имели все (100%) больных. По данным УЗИ у 14 (87,5%) больных отсутствовала перистальтика во всех отделах кишечника, а у 2 (12,5%) – маятниковые движения в левом подреберье. Свободная жидкость установлена в полости малого таза у 13 (81,25%) пациентов, а у 3 (18,75%) – по правому фланку. У 25% пациентов отсутствовал один из четырех главных признаков непроходимости кишечника, что указывает на атипичность клинической симптоматики течения болезни. Все больные оперированы. Установлены следующие спайки: множественные плоскостные у всех 16 больных, из которых на фоне плоскостных имели место и шнуровидные – у 8 (50,0%), а кольчужное полное покрытие с заворотом установлено у 4 (25,0) больных. Использование с целью разделения спаек струйного гидроскальпеля позволило предотвратить значительную часть недостатков стандартного разделения спаек. Осложнений при разделении спаек не было. Таким образом, метод хирургического лечения с использованием для разделения спаечного процесса струйного гидроскальпеля имеет щадящее нетравматична действие на сосуды и стенку кишки при разделении спаек, что в дальнейшем способствует более адекватному восстановлению перистальтики в ранний и отдаленный периоды после хирургического лечения. Во время операции, после разделения спаечного процесса струйным гидроскальпелем, у двух пациентов вследствие странгуляции возникла необходимость проведения сегментарной резекции тонкой кишки в объеме 25 см, наложен анастомоз конец в конец двухрядным швом.

Выводы. Использование метода дирекции спаек струйным гидроскальпелем в хирургическом лечении спаечного процесса брюшной полости и спаечной непроходимости позволяет прецизионное отделение органов от спаек и паренхиматозных органов. При этом удается минимизировать кровопотери, предотвратить повреждение анатомических структур и сократить время операции.

Ключевые слова: непроходимость кишечника, диагностика, лечение, струйный гидроскальпель.

Литература

1. Аверин В.И., Гринь А.И., Севковский А.И. (2015). Лечение аппендикулярного перитонита у детей на современном этапе. Хирургия. Восточная Европа. 3: 82–86.

2. Багмет Н.Н. (2003). Метод водоструйной диссекции при выполнении резекции печени. Автореферат дис. … канд. мед. наук: 14.00.27 хирургия. Москва: 16.

3. Грона В.М., Тейшейра Ж., Грона К.В. (2009). Етіопатогенетичні механізми розвитку первинного оментиту в дітей. Здоровье ребенка. 2: 73–74.

4. Анищенко В.В., Ганичев Д.А., Басс А.А., Васильев С.Л. (2013). Использование водоструйной диссекции в комплексном лечении осложненных форм диабетической стопы. Бюллетень РАМН. 33; 3: 63–66.

5. Мельниченко М.Г., Антонюк В.В., Квашніна А.А. (2015). Спайкова кишкова непрохідність у дітей. ХХІІІ з’їзд хірургів України, 21–23 жовт. 2015 р. Зб. наук. пр. Київ: Клінічна хірургія: 447–448.

6. Рибальченко В.Ф., Русак П.С. (2014). Гострий оментит у дітей: класифікація та вибір хірургічної тактики. Шпитальна хірургія. 1: 88.

7. Рибальченко В.Ф., Русак П.С., Доманський О.Б. (2014). До питання про дренування черевної порожнини при апендикулярному перитоніті у дітей. Шпитальна хірургія. 1: 108.

8. Переяслов А.А., Борова Л.Є., Бобак А.І. та ін. (2013). Ультрасонографія в діагностиці гострого апендициту в дітей. Хірургія дитячого віку. 3: 59–63.

9. Сушко В.И., Кривченя Д.Ю., Дегтярь В.А. и др. (2014). Хирургия детского возраста. Учебник. Под ред. В.И. Сушко, Д.Ю. Кривчени. Киев: Медицина: 568.

10. Rau HG, Zimmermann A, Wardemann C, Schildberg FW. 2003. Dissecting with the high-pressure water-jet. Standards of Surgical Techniques in Liver Metastases. Chirurgische Gastroenterologie. 19: 333–339.

11. Piek J, Oertel J, Gaab MR. 2002. Water-jet dissection in neurosurgical procedures: clinical results in 35 patients. Journal of Neurosurgery. 96: 690–696. https://doi.org/10.3171/jns.2002.96.4.0690; PMid:11990809

12. Kockerling F, Yildirim C et al. 2004. Total mesorectal excision with the water-jet dissection. Technique and results. Techniques in Coloproctology, Springer Milan. 8; Suppl 1: 217–225.

Видеолапароскопическое лечение при острой непроходимости кишечника, осложненной перитонитом

Острая спаечная непроходимость кишечника, осложненная перитонитом (ОСНКОП), — распространенное и тяжелое заболевание, при котором требуется экстренное хирургическое вмешательство [1, 3, 4, 6, 7, 9]. Вопросам совершенствования лечебно-диагностической помощи при ОСНКОП посвящено много исследований, однако, несмотря на постоянное совершенствование методов профилактики, диагностики и лечения при этом заболевании, сохраняется высокая летальность, которая по данным ряда авторов, варьирует от 9,6 до 65,7% [2, 5, 8, 10, 11, 13].

Целью работы явились снижение риска рецидива болезни, повышение уровня профилактики ОСНКОП с помощью современных методов лечения.

Задачи исследования:

1) совершенствование видеолапароскопической диагностики лечения при ОСНКОП;

2) совершенствование профилактики пареза кишечника в послеоперационном периоде;

3) определение показаний и противопоказаний к лапароскопическим методам лечения при ОСНКОП;

4) оценка эффективности применяемых методов.

Материал и методы

В хирургическом отделении клиники АндГосМИ и отделении экстренной хирургии ЦРБ Андижанского района за последние 5 лет лечились 59 больных с ОСНКОП. Распределение их по полу и возрасту приведено в таблице.

Из них 56 (94,9%) поступили с клинической картиной реактивной фазы перитонита, 3 (5,1%) — с токсической фазой.

По данным обследования больных до операции, о наличии распространенного спаечного процесса свидетельствовали множественные грубые послеоперационные рубцы, деформирующие переднюю стенку живота, а также анамнестические, клинические и инструментальные данные. У 17 (28,8%) пациентов пришлось отказаться от видеолапароскопического рассечения спаек (ВЛРС), санации и дренирования брюшной полости из-за высокого риска ятрогенного повреждения органов брюшной полости в условиях распространенного спаечного процесса. У этих больных в анамнезе имелись грубые келоидные рубцы на передней брюшной стенке после широкой срединной лапаротомии и операции по поводу спаечной острой непроходимости кишечника. При рентгенографии выявлены признаки спаечной болезни брюшной полости с нарушением пассажа по тонкой кишке. При ультразвуковом исследовании (УЗИ) получены данные об отсутствии свободных участков на передней брюшной стенке для введения троакаров и наложения пневмоперитонеума, а также признаки тотального спаечного процесса в брюшной полости.

Наш небольшой опыт лапароскопических операций позволяет рекомендовать комплекс предоперационного обследования больных со спаечной болезнью, осложненной перитонитом, включающий общий анализ крови и мочи, биохимию крови, обзорную контрастную рентгенографию брюшной полости, УЗИ брюшной полости и измерение внутрибрюшного давления.

Нами проанализирована информативность предложенных для диагностики спаечной болезни методов. При обзорной рентгенографии, выполненной всем больным при поступлении, выявлялись признаки непроходимости кишечника; чаши Клойбера и пневматизация петель тонких кишок, внутрибрюшное давление измерялось способом оценки давления в мочевом пузыре через катетер Фолея, подключенного к гидромонометру аппарата Вальдмана. У всех больных внутрибрюшное давление составило 16,3±0,8 мм вод.ст., что соответствовало I степени внутрибрюшной гипертензии. Для диагностики спаечной болезни с нарушением пассажа по кишечнику мы считаем более целесообразным использовать в динамике неинвазивную и безопасную ультразвуковую диагностику. Основная задача УЗИ — определение степени тяжести спаечной болезни брюшной полости. Благодаря УЗИ у 8 из 14 больных были намечены точки для безопасного введения троакара в брюшную полость. Информативность УЗИ в выявлении признаков спаечной болезни достигала 71,4% и была несколько выше, чем обзорное рентгенологическое исследование — 60—68%. Измерение внутрибрюшного давления позволяет определить степень внутрибрюшной гипертензии и фазы перитонита. Продолжительность хирургического вмешательства зависела от выраженности спаечного процесса, опыта и навыков членов хирургической бригады. Распространенность спаечного процесса существенно не влияла на длительность операции, так как внутрибрюшные сращения в основном располагались в зоне послеоперационного рубца. Разделение спаек, выявляемых в других анатомических областях, санация и дренирование брюшной полости проводили одномоментно, чаще только с использованием ножниц и электрокоагулятора, на что требовалось разное время.

В ходе выполнения ВЛРС, санации и дренирования брюшной полости у наших пациентов не было ни одного интраоперационного осложнения. Незначительное кровотечение, которое возникало при разделении сращений, чаще всего из большого сальника, останавливали с помощью электрокоагуляции в би- и монополярном режиме. В послеоперационном периоде осложнений, связанных с кровотечениями, также не отмечалось. После завершения вмешательства для профилактики спайкообразования в брюшную полость вводили реополиглюкин 400 мл и лидазу 64 ЕД. В послеоперационном периоде на 3—4-е сутки в стационаре назначали электрофорез контратубекса в виде геля, 5—7 сеансов на область послеоперационной раны. В амбулаторных условиях электрофорез контратубекса на переднюю брюшную стенку назначали в течение 15 дней, длительность сеансов на протяжении курса увеличивалась с 5 до 15 мин.

Тщательное обследование больных со спаечной болезнью до операции позволяет выявить факторы, нарушающие пассаж содержимого по кишечнику. Перед операцией хирург получает информацию о распространенности спаечного процесса и его выраженности, свободных от спаек участках на передней брюшной стенке для безопасного вхождения в брюшную полость и степени распространенности перитонита. Комплексное обследование с включением УЗИ, измерения внутрибрюшного давления и лапароскопии позволяют выявить противопоказания к ВЛРС.

Больным с ОСНКОП из-за некроза кишечника (n=17) проведена лапаротомия, 3 больным выполнены резекция некротического участка кишечника и анастомоз конец в бок инвагинационным методом.

Выполнение видеолапароскопического рассечения спаек, санации и дренирования брюшной полости позволило у всех 42 пациентов избежать интраоперационных осложнений, связанных с выполнением лапароскопической операции в условиях спаечного процесса, предупредить нарушения пассажа содержимого по кишечнику в послеоперационном периоде.

Наличие одной или нескольких срединных лапаротомий не являлось абсолютным противопоказанием к малоинвазивной операции.

В настоящее время лапароскопия не получила широкого применения в диагностике и лечении ОСНКОП. Большинство хирургов считают ее использование в условиях пареза кишечника и спаечного процесса не только нецелесообразным, но и опасным из-за возможности ятрогенного повреждения кишечника (в нашей практике отмечены случаи повреждения стенок кишки во время рассечения спаек, при этом поврежденный участок ушивали двухрядным швом).

Проанализировав результаты видеолапароскопического рассечения спаек, дренирования и санации брюшной полости, мы смогли сделать следующие выводы.

1. В настоящее время к показаниями к лапароскопии служат практически все случаи ОСНКОП в реактивной фазе.

2. Для повышения безопасности наиболее ответственного этапа операции — первичного вхождения в брюшную полость — большое значение имеет дооперационное определение мест припаянных к передней брюшной стенке кишечных петель, что в настоящее время возможно с помощью УЗИ брюшной полости и измерение внутрибрюшной гипертензии, а также использование безопасных способов первичного вхождения в брюшную полость (в модификации Поддубного, прямой пункции тупоконечным троакаром) оптических троакаров, методики открытой лапароскопии по Hasson.

Современные возможности видеолапароскопии, наличие соответствующих инструментов практически во всех случаях позволяют следующее:

— своевременно установить диагноз ОСНКОП;

— выполнить адекватный по объему, иногда весьма обширный, висцеролиз с разделением спаек, вызывающих непроходимость, осложненную перитонитом;

— добиться восстановления проходимости кишечника;

— использовать малотравматичный доступ к месту патологического очага;

— осуществить малотравматичную препаровку кишечных петель и спаек, санацию и дренирование брюшной полости;

— добиться минимума интраоперационных осложнений, облегчить течение послеоперационного периода;

— уменьшить количество и тяжесть послеоперационных осложнений;

— сократить длительность пребывания в стационаре больного, быстрее восстановить его полную физическую активность.

В настоящее время, как мы подчеркивали ранее, показанием к лапароскопии являются почти все формы ОСНКОП. Тем не менее противопоказаниями к видеолапароскопической операции служат:

— резкое вздутие кишечника при массивном спаечном процессе, которое можно предположить с учетом характера перенесенной операции и наличие рубцов на передней брюшной стенке;

— наличие «холодного» конгломерата из множества плотно спаянных между собой петель кишечника при поздней спаечной непроходимости кишечника;

— необратимые нарушения кровообращения в ущемленной кишке;

— токсические и терминальные фазы перитонита, сопровождающиеся полиорганной недостаточностью.

Выполнение видеолапароскопического рассечения спаек и санация брюшной полости позволяют не только устранить причину спаечной непроходимости кишечника, но и являются эффективным методом профилактики спаечной болезни после хирургического вмешательства. Метод полностью отвечает требованиям эстетической и косметической хирургии. Он предотвращает рецидив спайкообразования, что особенно важно для больных с предрасположенностью к спайкообразованию. Возраст и пол больного не влияют на непосредственные и отдаленные результаты видеолапароскопических вмешательств.

Лапароскопическое рассечение спаек в Воронеже — цена, телефон, запись онлайн

Спаечный процесс в малом тазу (спаечная болезнь, пластический пельвиоперитонит) – заболевание, характеризующееся образованием соединительнотканных тяжей, сращений между органами малого таза и/или внутренней выстилкой брюшины. По статистике спаечный процесс диагностируется у каждой четвертой женщины репродуктивного возраста.
Опасность спаечной болезни заключается в смещении внутренних органов, развитии хронического болевого синдрома, бесплодии, функциональном нарушении работы кишечника. Поэтому заболевание требует своевременного выявления и комплексного лечения.

Причины развития спаечной болезни

Основной причиной развития спаечной болезни является усиленное разрастание соединительной ткани. Провоцирующими факторами данного процесса считаются:

  • травмы в анамнезе;
  • операции на малом тазу;
  • внутренние кровоизлияния;
  • эндометриоз;
  • воспалительные заболевания органов малого таза.

Наличие 2 факторов и более в несколько раз увеличивает риск развития спаек. При выявлении спаечного процесса показано проведение оперативного вмешательства. Операция позволит устранить проблему и сохранить репродуктивную функцию.

Тактика лечения спаечного процесса

В случае обнаружения спаечного процесса тактика лечения зависит от степени выраженности и тяжести заболевания. При остром течении патологии операция – единственный способ решения проблемы. Во время проведения диагностической лапароскопии маточных труб, матки, яичников одновременно выполняется удаление спаек. Преимуществами лапароскопического вмешательства являются быстрый период реабилитации, выраженный эффект, отсутствие больших разрезов.

Противопоказания к операции

Выполнение операции противопоказано при наличии следующих состояний:

  • инфекционно-воспалительные заболевания в острой фазе;
  • хронические заболевания в стадии декомпенсации;
  • почечная и печеночная недостаточность тяжелой стадии;
  • патология свертываемости крови;
  • период беременности;
  • обменные нарушения, не поддающиеся коррекции.

Некоторые из перечисленных ограничений являются относительными. После проведенного лечения повторно рассматривается вопрос о возможности выполнения оперативного вмешательства.

Подготовка

Подготовка перед операцией необходима для своевременного выявления противопоказаний. Требуется выполнить следующие обследования:

  • общий анализ крови;
  • общий анализ мочи;
  • биохимический анализ крови;
  • коагулограмму;
  • кровь на RW, гепатит В и С, ВИЧ;
  • группу крови и резус-фактор;
  • рентген органов грудной клетки или флюорографию;
  • ЭКГ;
  • УЗИ органов малого таза.

 

Заключение о возможности оперативного вмешательства выдает врач-терапевт. При наличии хронических заболеваний может потребоваться консультация узких специалистов.

Операция выполняется натощак. Последний прием пищи должен быть за 8-10 часов до вмешательства.

Если у вас остались вопросы по поводу подготовки к операции, вы можете задать их врачу на консультации. Специалисты SmartClinic готовы принять в любое удобно для вас время. Запись на прием осуществляется по телефону +7 (473) 211-42-24. Также вы можете оставить заявку для звонка на сайте.

Ход операции

Вид обезболивания – общий наркоз.

Операция выполняется при помощи специального инструмента – лапароскопа. Его вводят в брюшную полость через небольшие надрезы, длиной до 2 см. Врач наблюдет за ходом операции через экран монитора. Для облегчения доступа в просвет полости малого таза вводится инертный газ. После осмотра врач определяет расположение спаек и под контролем камеры производит их рассечение с удалением. Поврежденные сосуды прижигаются электрокоагулятором. Завершается операция наложением швов.

Послеоперационный период

Лапароскопическая операция характеризуется непродолжительным периодом восстановления. При отсутствии жалоб и хорошем самочувствии вы сможете отправиться домой на следующий день после вмешательства. Допускается наличие умеренного болевого синдрома, который купируется приемом обезболивающих лекарственных средств. Средняя продолжительность реабилитационного периода – 4-6 недель. На это время рекомендуется:

  • исключить тяжелые физические нагрузки;
  • отказаться от посещения саун, бань, бассейна;
  • исключить из рациона продукты, способствующие повышению газообразования;
  • исключить половые контакты.

Задать интересующие вопросы по поводу операции, а также записаться на прием к врачу можно по телефону +7 (473) 211-42-24 или оставить онлайн-заявку для звонка на сайте. Наш сотрудник свяжется с вами в ближайшее время.

Лечение спаечной болезни. Список клиник, рейтинг, отзывы, цены

Спаечный процесс брюшной полости в основном возникает после операций, особенно полостных. С меньшей вероятностью спайки образуются после лапароскопических вмешательств. Спайки в кишечнике – основная причина тонкокишечной непроходимости. Спаечная болезнь часто требует хирургического лечения. Это тяжелое заболевание с летальностью до 15-20%.

Содержание

  1. Причины
  2. Степени тяжести
  3. Симптомы
  4. Диагностика
  5. Принципы лечения
  6. Операции при спаечной болезни
  7. Куда обратиться

Причины

В 75% случаев причина спаек – хирургическая операция. Другие причины: воспалительные процессы, травмы живота, врожденные аномалии. Не у всех людей образуются спайки даже после обширных хирургических вмешательств. Чтобы они появились, должна быть генетическая предрасположенность.

Степени тяжести

Степени тяжести хронической спаечной болезни:

  • 1 степень – процесс ограничен зоной послеоперационного рубца.
  • 2 степень – появляются единичные спайки в других областях брюшной полости.
  • 3 степень – спайки занимают треть и более всей брюшной полости.
  • 4 степень – спайки занимают две трети брюшной полости.

Симптомы

Симптомы могут возникнуть внезапно или прогрессируют постепенно. Основные проявления:

  • повышение температуры тела;
  • тошнота;
  • рвота;
  • боль в животе;
  • вздутие живота;
  • неустойчивый стул;
  • рвота, появляющаяся при физической нагрузке.

Диагностика

Стандартный способ диагностики – рентгенография. Но она информативна только в 50% случаев.

В последние годы всё чаще используют УЗИ. Это исследование недорогое, быстрое, безболезненное, не дает лучевой нагрузки. Его можно многократно повторять для оценки состояния кишечника в динамике.

За рубежом часто используют компьютерную томографию. Это самый точный метод диагностики. Он дороже стоит и связан с большей лучевой нагрузкой на организм, чем рентген. Поэтому КТ не проводят всем пациентам с кишечной непроходимостью и спайками. Его применяют в неопределенных диагностических ситуациях. Основная роль КТ – определить, нужна ли пациенту хирургическая операция. Метод исследования дает достоверную информацию о происхождении кишечной непроходимости. Врач может исключить случаи, когда эта патология не связана со спаечной болезнью, а также определить, является ли кишечная непроходимость полной.

Диагностика может проводиться с использованием водорастворимого контраста, который принимают внутрь. Стандартный для обследования кишечника бариевый контраст в таких случаях не используют. В случае перфорации кишечника он может попасть в брюшную полость, что станет причиной осложнений.

МРТ используют редко. Методика применяется вместо КТ, если этому варианту диагностики или йодсодержащему контрасту (его вводят внутривенно) есть противопоказания.

Принципы лечения

Примерно в 70% случаев добиться улучшения удается с помощью консервативной терапии. Врачи применяют препараты: ферменты, глюкокортикоиды, спазмолитики, антихолинестеразные средства, фибринолитики, антикоагулянты. 

В 30% случаев требуется хирургическое лечение спаечной болезни. Показания к операции:

  • нет эффекта от консервативного лечения спаечной болезни брюшной полости;
  • ухудшение состояния больного;
  • развитие острой кишечной непроходимости.

Операции при спаечной болезни

Для хирургического лечения спаек брюшной полости проводятся такие хирургические вмешательства:

Лапароскопический адгезиолизис – основная хирургическая операция в Европе. Врачи выполняют рассечение и разделение спаек, чтобы восстановить проходимость тонкого кишечника. Исследования показали, что лапароскопия не уступает в эффективности открытой операции. При этом достигается ряд преимуществ:

  • ниже риск осложнений;
  • меньше травма;
  • ниже риск образования новых спаек;
  • быстрое восстановление пациентов после хирургического вмешательства.

Резекция кишечника – выполняется в случае его отмирания. При кишечной непроходимости нарушается его кровоснабжение. В результате стенка кишечника может быть необратимо повреждена. Врач удаляет часть тонкой кишки и накладывает анастомоз – соединяет концы кишечника, чтобы восстановить непрерывность желудочно-кишечного тракта.

Энтеропликация – наложение швов на брыжейку кишечника с целью ограничения подвижности. Применяется для предотвращения повторного развития спаечной непроходимости тонкой кишки.

Юнотрансверзоанастомоз или илеотрансверзоанастомоз – формирование обходного пути для продвижения пищевого комка из разных отделов тонкого кишечника в поперечную ободочную кишку (участок толстого кишечника).

Куда обратиться

В случае развития спаечной болезни кишечника, вы можете поехать для её лечения за границу. Специалисты Booking Health подберут для вас лучшую клинику по лечению спаечной болезни за рубежом. Мы организуем для вас срочное лечение и экстренную хирургическую операцию в одной из развитых стран.

Несколько причин, почему стоит пройти лечение спаечной болезни за границей:

  • В большинстве случаев хирургический адгезиолизис проводится лапароскопическим, а не открытым способом.
  • Предпочтение всегда отдается щадящим операциям без удаления части кишечника.
  • Минимальная вероятность перехода от лапароскопии к открытой операции.
  • Возможность малоинвазивного лечения спаек любой локализации: брюшной полости, спаек малого таза.
  • Врачи используют барьерные противоспаечные средства, такие как биорезорбируемая мембрана Seprafilm. Они разделяют раневые поверхности на время, необходимое для регенерации брюшины.
  • Низкий риск осложнений.
  • Успешное проведение даже самых сложных хирургических вмешательств.2010

    © Коллектив авторов, 2010

    УДК 616.348-089.86-06:617.55-007.274-089

    И.А. Матвеев, А.И. Матвеев, Б.К. Гиберт, Н.А. Бородин

    СПАЕЧНЫЙ ПРОЦЕСС БРЮШНОЙ ПОЛОСТИ У БОЛЬНЫХ С КОНЦЕВЫМИ КОЛОСТОМАМИ И ВЛИЯНИЕ ЕГО НА ВОССТАНОВЛЕНИЕ НЕПРЕРЫВНОСТИ ТОЛСТОЙ КИШКИ

    Кафедра факультетской хирургии (зав. — д-р мед. наук Б.К. Гиберт) ГОУ ВПО Тюменской государственной медицинской академии

    Ключевые слова: концевые колостомы, восстановительные операции,спаечный процесс.

    Введение. Топографоанатомическое строение брюшной полости после проведенных лапаротомий изменяется вследствие реконструкции оперированных органов и адгезивного процесса, который меняет топографию прежде всего петель кишечника и сальника.

    У этих больных в дальнейшем может возникать необходимость в хирургической коррекции последствий операций или возникающих заболеваний. Вмешательства при этом более травматичные, чем такого же объема операции, выполненные при отсутствии спаечного процесса в брюшной полости [6]. Так, при восстановлении непрерывности кишечника у пациентов с концевыми колостомами длительность операции, уровень интраоперацион-ных и послеоперационных осложнений во многом определяются выраженностью спаечного процесса в брюшной полости [2, 4].

    Детальных исследований, изучающих особенности распространения и интенсивности спаечного процесса, выполнения операций, выбора доступа с учетом локализации адгезивных сращений брюшной полости недостаточно, вследствие недооценки проблемы послеоперационных спаек [5].

    Цель и задача исследования — изучить характер и влияние спаечного процесса на восстановление непрерывности кишечника и определить способы, улучшающие результаты восстановительных операций у больных с концевыми кишечными свищами.

    Материал и методы. С 1999 г. по I полугодие 2009 г. восстановительные операции проведены 79 больным с концевыми колостомами. Летальных исходов не было. Средний возраст пациентов — (46,8±3,1) года. Мужчин — 40, женщин — 39. Причиной формирования стом были: травма толстой и прямой кишки — у 20 (25,3%) больных, диверти-кулярная болезнь — у 29 (36,7%), рак ободочной и прямой кишки — у 17 (21,5%), заворот сигмовидной кишки — у 4

    (5,1%), тромбоз ветвей нижнебрыжеечной артерии — у 3 (3,8%), ущемленная грыжа и деструктивный панкреатит — по 2 (2,5%), пиосальпинкс и долихомегаколон — по 1 (1,3%) больному. Все, кроме 1, оперированы в экстренном и срочном порядке. Гемиколонэктомия проведена 7 больным, у остальных — резекция в пределах 1-2 сегментов толстой кишки. Первичное восстановление непрерывности кишечника не проведено из-за перитонита у 51 (64,9%) больного, неподготовленности кишки — у 21 (26,2%) пациента, шока — у 8 (9,5%). У большинства больных с шоком и неподготовленной кишкой был местный перитонит и инфицирование брюшной полости. У 19 (24,0%) человек выполнены оперативные вмешательства непосредственно до или после формирования свища по поводу различных осложнений со стороны органов брюшной полости. У всех пациентов был срединный послеоперационный рубец, а также рубцы в других отделах брюшной стенки после дренирования, вскрытия гнойников, флегмон.

    Свищи были различного уровня: сигмостома — у 46 (58,2%), трансверзостома — у 19 (24,1%), десцендостома — у 11 (13,9%), асцендостом — у 3 (3,8%).

    Восстановительные операции выполнены после первичного вмешательства через 2-3 мес у 9 человек (11,4%), 4-6 мес — у 28 больных (35,4%), 7-12 мес — у 29 (36,7%) пациентов и свыше 1 года — у 13 (16,4%).

    Для проведения восстановительной операции все больные поступали в плановом порядке в удовлетворительном состоянии. Диагностический алгоритм проведен в соответствии со стандартами обследования больных с кишечными свищами. Для выбора доступа обращали внимание на расположение, подвижность предполагаемых к анастомози-рованию сегментов ободочной и прямой кишки. Выполняли компьютерную томографию для определения локализации ушитой механическим швом культи кишки в брюшной полости и ее проекции на переднюю брюшную стенку с целью выбора доступа у 7 человек.

    Методы обезболивания во время операции — эндотрахе-альный наркоз у 74 больных, в том числе у 7 — в комбинации с длительной эпидуральной блокадой и у 5 человек — эпиду-ральная блокада в качестве моноанестезии.

    У 61 пациента во время лапаротомии, независимо от доступа, в области срединного послеоперационного рубца, культи заглушенной кишки и стомы изучена интенсивность спаечного процесса в соответствии с классификацией, предложенной Д.М.Балаценко (1957): единичные спайки — I степень,

    Таблица 1

    Интенсивность спаечного процесса у больных с концевыми колостомами

    Интенсивность спаечного процесса, степень Срединный рубец Стома Культя кишки

    Абс. число % Абс. число % Абс. число %

    I 7 11,5 10 16,4 16 26,2

    II 13 21,3 24 39,3 14 22,9

    III 41 67,2 27 44,3 31 50,9

    множественные — II степень и сплошные — III степень поражения.

    В области срединного рубца сплошные сращения (IV степень) встречались чаще, чем в области культи заглушенной кишки и стомы. Спаечные образования I и II степени чаще наблюдались в области стомы и реже — срединного послеоперационного рубца (табл. 1).

    В связи с особенностями распространения спаечного процесса в брюшной полости изучено влияние спаек на восстановление непрерывности кишечника из срединного и парастомального доступов.

    Срединным доступом оперированы 42 пациента и пара-стомальным — 37.

    При срединной лапаротомии, как показали измерения, объекты операции находятся в стороне от раны, удовлетворительные условия оперирования достигаются за счет увеличения её размеров и коррекции раны ранорасширителя-ми. Размер срединного доступа был (19,50±3,61) см.

    Длительность операции, выполненной из срединной лапаротомии, составила (172,32±8,4) мин, продолжительность этапа рассечения спаек — (68,4±10,02) мин, кровопотеря — (268,7±20,7) мл (табл. 2). У 5 больных (11,9%) во время операции при разделении спаек была перфорирована стенка тонкой кишки и у 1 больного — мочеточник. У 2 — резецирована петля кишки и наложен анастомоз, 1 — произведено ушивание раны кишечной стенки и 1 — мочеточника. У 2 больных, в том числе у больной, которой была резецирована петля кишки, повреждение стенки не было замечено. У 14 человек повреждения были поверхностными. После операции устойчивая перистальтика появилась через (3,26±0,27), отхождения газов — (4,13±0,30), первый стул — (5,58±0,33) дня.

    Послеоперационные осложнения были у 23 (54,8%) человек. Нагноение ран произошло у 6 больных (14,3%). Релапаротомия выполнена 3 (7,1%) больным: у 1 — в связи с эвентрацией, у 2 — из-за незамеченных во время операции повреждений кишки. После релапаротомии у 1 больной возникли тонкокишечные свищи, которые закрылись после консервативного лечения, у 2-го — послеоперационный период протекал без осложнений. У 1 больного дренирована гематома локальным доступом, у 2-й — лечение инфильтрата малого таза проведено без операции. Парез, разрешившийся консервативно, возник у 5 человек. У 3 больных наблюдались кровотечения из пищевода и желудка, которые остановлены медикаментозным лечением, и у 1 больного развилась госпитальная пневмония. У 3 человек возник послеоперационный психоз.

    При парастомальной лапаротомии после иссечения свища рана продлялась в направлении заглушенной кишки по типу одного из стандартных оперативных доступов до появления ее в зоне визуального контроля. У 7 человек рана трансформирована в поперечный, у 17 — в косопере-менный, у 4 — в трансректальный и у 9 — параректальный

    доступы. Объекты операции находятся в центре раны, средний размер ее составил (13,41±0,5) см. Операции длились (148±9,76) мин, время рассечение спаек — (41,32±3,2) мин, кровопотеря — (139,42±24,26) мл (см. табл. 2).

    Вскрытие просвета кишки было у 2 (5,4%) больных, дефект своевременно обнаружен и ушит. У 9 человек был поврежден серозомышечный слой стенки кишки. В послеоперационном периоде перистальтика возобновилась через (1,60±0,11) дня, газы отошли через (2,20±0,11) и стул — (3,67±0,21) дня.

    Осложнения после операции были у 15 (40,5%) человек. Раневая инфекция возникла у 7 больных (18,9%). Осложнения, потребовавшие релапаротомии, были у 3 (8,1%) человек: некроз большого сальника, вследствие перевязки его сосудов при мобилизации поперечной кишки, внутрибрюшное кровотечение из рассеченных спаек и абсцесс левой подвздошной области. Парез кишечника был у 1 пациента. Наблюдалось кишечное кровотечение из язвы двенадцатиперстной кишки у 2 больных, остановленное консервативной терапией. Соматические осложнения были у 2 больных: пневмония и психоз, что потребовало госпитализации пациента в реанимационное отделение.

    Результаты и обсуждение. Исследование особенностей адгезивного процесса у больных с концевыми колостомами показало, что спайки возникли у всех больных, которым сформирован свищ. Это связано с особенностями операции на прямой и ободочной кишке, их травматичностью, инфицированностью брюшной полости [1, 2, 6]. Выраженный спаечный процесс в области срединного рубца был у 41 (67,2%), культи кишки — у 31 (50,9%) и колостомы у 27 (44,3%) больных. В области срединного

    Таблица 2

    Параметры хирургических вмешательств при восстановлении непрерывности кишечного тракта (M±m)

    Критерий травматичности Парастомальный доступ Срединный доступ

    Длина раны,см 11,41±0,50 19,70±3,61

    Длительность операции, 148±9,76 172,32±8,4

    мин

    Время разделения спа- 41,32±4,16 68,40±10,02

    ек, мин

    Кровопотеря, мл 139,42±24,26 268,7±20,7

    ^критерий Стьюдента р<0,05.

    И.А. Матвеев и др.

    «Вестник хирургии»*2010

    рубца преобладали висцеропариетальные спайки, которые фиксировали петли кишки, сальник к предлежащей передней брюшной стенке. В области стомы и культи заглушенной кишки висцеропариетальные спайки встречались реже, чаще — висцеровисцеральные образования. Сращения между передней брюшной стенкой и внутренними органами возникали в месте стояния дренажей, вскрытия гнойников. Вокруг культи заглушенной кишки адгезивные структуры различной формы образовывали конгломерат, состоящий из сальника, петель кишечника, культи брыжейки. Из-за спаечных сращений технические трудности чаще возникали при выделении культи заглушенной кишки, чем стомы.

    Одной из причин интенсивного спаечного процесса были остаточные проявления перенесенного перитонита. У 11 человек обнаружены хронические абсцессы различной величины, оментит, внутренний свищ культи заглушенной кишки, вокруг которых формировались воспалительно-спаечные инфильтраты.

    Срединная лапаротомия применялась при необходимости колопластики, когда ее невозможно выполнить из парастомального доступа, при проведении симультанных операций и короткой культе прямой кишки. Колопластика выполнена у 9 человек, в том числе у 6 была короткая культя прямой кишки. У 22 больных для сопоставления анастомозируемых сегментов было достаточным выделить их из спаек, что можно было бы сделать из парастомального доступа. Это связано с отсутствием в тот период дифференцированного подхода к выбору оперативного доступа, когда все восстановительные операции у больных с концевыми колостомами проводились из срединной раны.

    Парастомальный доступ планировался при локализации стомы и культи заглушенной кишки в одной или соседних анатомических областях брюшной полости. По мере накопления опыта выполняли несложные виды колопластик. У двух больных из трансректальной лапаротомии произведена мобилизация и низведение селезеночного изгиба кишки с наложением десцендоректоанастомоза, у 2 человек поперечным доступом мобилизован селезеночный угол ободочной кишки и восстановлена непрерывность поперечной кишки. Случаев перехода парастомального доступа на срединный не было.

    У 4 пациентов пожилого и старческого возраста со срединными вентральными грыжами и тяжёлой соматической патологией восстановление кишечной непрерывности выполнено под перидуральной анестезией из косопеременного парастомального доступа, как менее травматичного.

    Продолжительность оперативного вмешательства в значительной степени зависела от времени рассечения спаек, которое при срединном и парастомальном доступах достоверно отличается (р<0,05). При срединном доступе иссекался послеоперационный срединный рубец, рассекались спайки, прилежащие к нему, разделялись сращения для подхода к объектам вмешательства, находящихся вне апертуры раны, и только после этого этапы операции совпадали при обоих доступах: выделение свища и культи кишки из спаек, их сопоставление и наложение анастомоза. Кроме того, размеры срединной раны превышают длину парастомальной (р<0,05), в связи с чем необходимо дополнительное время на выделение ее краев от спаек. При парастомаль-ном доступе, после выделения свища из брюшной стенки, рана продлялась в пределах неизмененной передней брюшной стенки, объекты операции находились в центре раны, висцеропариеталь-ные спайки встречались редко. Время подготовки сегментов кишки и наложение анастомоза было практически одинаково: (71,68±12,3) мин — при парастомальном и (68,92±10,2) мин — при срединном доступе (р>0,05).

    Интраоперационные осложнения были связаны с разделением адгезивных сращений и чаще возникали при проведении срединной лапа-ротомии. Повреждения петель кишечника при иссечении послеоперационного рубца нередки и существуют различные приемы, помогающие выполнить лапаротомию без повреждения органов брюшной полости, практически все они предполагают смещать разрез в сторону, вверх или вниз, где, как правило, спаечный процесс меньшей интенсивности [1]. Во время операции из срединного доступа у 2 больных на фоне множественных десерозаций не были замечены сквозные раны тонкой кишки. Такие осложнения при восстановительных операциях у больных с концевыми свищами могут привести к летальным исходам [3]. При восстановлении непрерывности кишечника из парастомального доступа его повреждения носили одиночный, изолированный характер и происходили при поиске и выделении культи кишки.

    Интраоперационная кровопотеря возникала при рассечении ангиоматозных спаек, повреждениях стенки кишки, брыжейки, сальника, которые происходили при разделении сращений и зависела от продолжительности и травматичности этого этапа операции, в связи с чем кровопотеря у больных, оперированных парастомальным доступом, была достоверно меньше (р<0,05).

    Двигательная функция кишечника восстанавливалась на 1,5-2 сут раньше у больных, оперированных парастомальным доступом. Более быстрое восстановления функции кишечника

    связано с меньшей травматичностью операции, обусловленной прямым непосредственным подходом к объектам операции, что позволило не касаться основной массы петель кишечника и его брыжейки, которые остаются в стороне от зоны операционного действия и, вследствие этого, не травмируются. Этим же можно объяснить значительную разницу в возникновении послеоперационных парезов у больных, оперированных различными доступами, у 5 человек — после срединной лапаротомии и у 1 — после парасто-мального рассечения брюшной стенки.

    Таким образом, после операции формирования концевой колостомы чаще выраженные сращения развиваются в области срединного рубца, заглушенной культи кишки и реже — вокруг колостомы. Травматичность рассечения спаек влияет на продолжительность вмешательства, частоту интра- и послеоперационных осложнений, сроки восстановления моторной функции кишечника и зависит от оперативного доступа, что необходимо учитывать при его выборе. Восстановление непрерывности кишечника из парастомального доступа позволяет избежать зоны срединного рубца, где преобладают выраженные по интенсивности висцеропариетальные и висцеровисцеральные адгезивные сращения, значительно затрудняющие проведение операции. В то же время из парастомальной лапаротомии невозможно выполнить сложные виды колопла-стик и симультанных операций.

    Выводы. 1. У всех больных, оперированных на толстой кишке с формированием концевой коло-стомы, развивается спаечный процесс брюшной полости, чаще локализующийся в области срединного послеоперационного рубца, заглушенной культи кишки и в меньшей степени — колостомы. Он является одним из обстоятельств, влияющих на результаты восстановительных операций.

    2. При восстановлении непрерывности кишки из парастомального доступа объемы рассечения спаек меньше, чем при срединном, что снижает уровень интра- и послеоперационных осложнений

    и определяет более легкое течение послеоперационного периода.

    БИБЛИОГРАФИЧЕСКИЙ СПИСОК

    1. Воробьев А.А., Бебуришвили А.Г. Хирургическая анатомия оперированного живота и лапароскопическая хирургия спаек.-Волгоград: Государственное учреждение «Издатель», 2001.-240 с.

    2. Воробьев Г.И., Саламов К.Н., Вышегородцев Д.В. Восстановление естественного кишечного пассажа после операции Гартмана при короткой культе прямой кишки // Хирургия. — 1992.—№ 4.-С. 31-37.

    3. Луцевич О.Э., Галламов Э.А., Толстых М.П. и др. Лапароскопические реконструктивные вмешательства в колопрок-тологии // Актуальные вопросы колопроктологии: Материалы 2-го съезда колопроктологов России.—Уфа, 2007.—С. 589590.

    4. Федоров В.Д., Кубышкин В.А., Козлов И.А. Хирургическая эпидемиология образования спаек в брюшной полости // Хирургия.—2004.—№ 6.—С. 50-53.

    5. Черкес В.Л., Кныш В.И. Восстановление непрерывности кишечной трубки у больных с колостомой // Хирур-гия.—1997. —№ 9.—С. 19-22.

    6. Parker M.C., Ellis H., Moran B.J. et al. Postoperative Adhesions: Ten-Year Follow-Up of 12, 584 Patients undergoing lower abdominal surgery // Dis. Colon Rectum.—2001. — Vol. 44, № 6. — P. 822829.

    Поступила в редакцию 13.11.2009 г.

    I.A.Matveev, A.I.Matveev, B.K.Gibert, N.A.Borodin

    ADHESIVE PROCESS IN THE ABDOMINAL CAVITY IN PATIENTS WITH END COLOSTO-MIES AND ITS INFLUENCE ON THE REESTABLISHMENT OF THE LARGE INTESTINE CONTINUITY

    Under analyses there were reparative operations on 79 patients with end colostomies performed using medial access in 42 patients and parastomal access in 37 patients. The investigation of prevalence of the adhesive process in 61 patients has shown that marked adhesions were formed in the area of the medial scar in 41 (67.2%) patients, the stump of the suppressed gut — in 31 (50.9%) patients and colostomy — in 27 (44.3%) Reestablishment of intestine continuity from the parastomal access allowed avoidance of adhesions in the zone of the medial postoperative scar which shortened the time of operation and decreased the level of intra- and postoperative complications.

    Послеоперационные спайки вызываются кальцийзависимыми мембранными мостиками между мезотелиальными поверхностями

    Культура клеток

    Клетки Met-5A культивировали в 10% FBS (Sigma Aldrich, #F9665), F199 (Sigma Aldrich, #M4530), 18 нг/мл EGF (R&D systems, #236-EG), 400 нМ гидрокортизона (Sigma Aldrich, #h5001), 16 нг/мл инсулин-трансферрин-селен (Gibco, #41400045), 10 мМ HEPES (Gibco, #15630080) , 2,5  мг/л амфотерицина (Gibco, № 5000980), микроэлементов В (Corning, № 15343641), 50 ЕД Пенстрепа (Gibco, № 15070063).После шока от высыхания клетки культивировали в «среде для анализа»: 2% FBS, 10 мМ HEPES, микроэлементы B и 50 единиц Penstrep. Клетки культивировали на чашках, покрытых 2% желатином (Sigma Aldrich, #G1393). Клетки пассировали, используя PBS и трипсин-ЭДТА (Sigma Aldrich, #T4049).

    Стабильные клеточные линии

    Клетки трансфицировали соответствующими плазмидами PiggyBac и Helper с использованием Lipofectamine 2000 (Invitrogen, #11668) в соответствии с инструкциями производителя. Через 48 ч среду заменяли средой, содержащей 10 нг/мл пуромицина (Tebu-Bio, #BIA-P1230).Среду заменяли через день до 2 недель селекции, после чего трансгены стабильно экспрессировались.

    Выделение и культивирование первичных клеток

    5 мл предварительно подогретой среды для диссоциации (среда Игла, модифицированная Дульбекко (DMEM, Life Technologies, #10565-042), коллагеназа IV (50 мг/мл, Worthington Biochemical) и 20 мкМ CaCl 2 вводили в брюшную полость свежезабитым мышам дикого типа C57BL/6JIV. Через 5 мин полученную клеточную суспензию собирали, процеживали через фильтр 100 мкм, центрифугировали и промывали 2% фетальной бычьей сывороткой (FBS, Sigma Aldrich , #F9665) в PBS.Затем клетки сортировали с использованием технологии MACS® (Miltenyi Biotec). Клетки PDPN+ LYVE1-CD31-CD45- культивировали в среде DMEM с добавлением 10% FBS и 50 единиц Penstrep (Gibco, #15070063).

    Измерение люциферазы и нанолюциферазы

    Клетки инкубировали с ледяным буфером для лизиса люциферазы (25 мМ Tris-HCL pH 7,8, 1% Triton X-100, 15 мМ MgSO 4 , 4 мМ EGTA, 1 мМ мМ EGTA, DTT) 20 мин. Оба анализа были выполнены в формате 96-луночных планшетов. Субстрат люциферазы светлячков растворяли в PBS и состояли из 20 мМ трицина, 2.67 мм MGSO 4 , 0,1 мм EDTA, 33,3 мМ DTT, 0,52 мм АТФ, 0,27 мм ацетил-COA, 5 мМ NaOH, 50 мМ MGCO 3 и 0,47 мм D-Luciferin (Carl Roth, # CN24.3 ). Для нанолюциферазы раствор субстрата включал 47,2 мкМ целентеразина (Carl Roth, #4094.4). Люминесценцию обнаруживали через 5 мин совместной инкубации субстрата и лизата с использованием модульного многорежимного считывателя микропланшетов TriStar² LB 942 (Berthold Technologies).

    Высокопроизводительный анализ адгезии носителя к носителю

    Клетки Met-5A высевали вместе с микроносителями Cytodex® 3 (Sigma Aldrich, #C3275) в соотношении 500:1 и оставляли для прилипания и роста в течение 5 дней.Затем гранулы, покрытые клетками, элюировали из чашки для культивирования с помощью полоски на 25 мл. Полученный раствор процеживали через 100-мкм фильтр для клеток (Corning, #352360). Шок от высыхания индуцировали, помещая клеточный фильтр с шариками под работающий колпак для культивирования клеток на 15 мин. После этого шарики элюировали средой для анализа и помещали в чашку для культивирования, покрытую раствором силиката HEMA (Sigma Aldrich, #P3932), чтобы предотвратить прикрепление клеток. После указанных моментов времени комплексы носителей собирали путем их фильтрации через клеточный фильтр с размером ячеек 200 мкм, который позволяет проходить отдельным носителям, задерживая при этом комплексы носителей.Адгезии измеряли высокопроизводительным способом с использованием клеток Met-5A, стабильно экспрессирующих люциферазу (AF23) или нанолюциферазу (AF1), с использованием пипеток Integra Viaflo.

    Высокопроизводительный анализ адгезии носителя к монослою

    Клетки Met-5A высевали на покрытые желатином чашки (Sigma Aldrich, #G1393). Как только был установлен конфлюэнтный монослой, на монослой высевали покрытые клетками шарики, подвергшиеся стрессу. Для ингибирующих экспериментов, если не указано иное, клетки предварительно обрабатывали указанным соединением в течение 30 мин в культуральной среде.После этого проводили анализ адгезии, как описано выше.

    Маркировка микроносителя

    Микроноситель Cytodex3, окрашенный Alexa Fluor 488 NHS Ester (Thermo; A20000) или Alexa Fluor 568 NHS Ester (Thermo; A20003) в соответствии с инструкциями производителя. Меченые микроносители интенсивно промывали полной средой и использовали, как описано выше.

    Анализ Cre-обменной передачи

    Клетки Met-5A, стабильно экспрессирующие Cre-рекомбиназу (AF32), высевали на гранулы микроносителя Cytodex® 3 (Sigma Aldrich, #C3275), подвергали шоковому обезвоживанию, как описано, и помещали на Met- 5A монослой, стабильно экспрессирующий репортерную конструкцию dTomato-P2A-NanoLuciferase (AF34).Люминесценцию нанолюциферазы измеряли через 48 часов. Это представляет собой начальную стресс-зависимую передачу.

    Клетки Met-5A дикого типа затем высевали на монослой, подвергали шоку от высыхания и помещали вместе с не подвергнутыми стрессу покрытыми клетками гранулами, которые стабильно экспрессируют рекомбиназу Cre (AF32) на 3 часа. Затем носители отделяли от монослоя и помещали на не подвергавшийся стрессу монослой Met-5A, стабильно экспрессирующий репортерную конструкцию dTomato-P2A-NanoLuciferase (AF34). Люминесценцию нанолюциферазы измеряли через 48 часов.Это первая передача, независимая от напряжения.

    Гранулы дикого типа, покрытые клетками, затем подвергали шоковому обезвоживанию и высевали на не подвергавшийся стрессу монослой Met-5A дикого типа на 3 часа. Затем носители отделяли от монослоя и помещали на покрытые клетками не подвергнутые стрессу шарики, стабильно экспрессирующие рекомбиназу Cre (AF32), на 3 часа. Затем носителей выделяли еще раз и помещали на не подвергавшийся стрессу монослой Met-5A, стабильно экспрессирующий репортерную конструкцию dTomato-P2A-NanoLuciferase (AF34).Люминесценцию нанолюциферазы измеряли через 48 часов. Это представляет собой вторую передачу, независимую от напряжения.

    Эта процедура была продолжена аналогичным образом для третьей и четвертой передач подряд.

    Анализ распространения адгезии

    Клетки Met-5A, стабильно экспрессирующие нанолюциферазу (AF1), высевали на гранулы микроносителя Cytodex® 3 (Sigma Aldrich, #C3275) и подвергали шоку от высыхания, как описано, и помещали на Met- 5А монослой. Через 24 ч несвязанные носители отмывали и измеряли люминесценцию нанолюциферазы.Это представляет собой первоначальную передаваемую адгезию, зависящую от напряжения.

    Клетки Met-5A дикого типа затем высевали на монослой, подвергали воздействию шока от высыхания и помещали вместе с покрытыми клетками гранулами, которые стабильно экспрессируют нанолюциферазу (AF1) в течение 3 часов. Затем носители отделяли от монослоя и помещали на не подвергавшийся стрессу монослой Met-5A дикого типа. Через 24 часа несвязавшиеся шарики смывали и измеряли люминесценцию нанолюциферазы. Это представляет собой первую переносимую адгезию, независимую от стресса.

    Гранулы дикого типа, покрытые клетками, затем подвергали шоковому обезвоживанию и высевали на не подвергавшийся стрессу монослой Met-5A дикого типа на 3 часа. Затем носители отделяли от монослоя и помещали на покрытые клетками не подвергнутые стрессу шарики, стабильно экспрессирующие нанолюциферазу (AF1), на 3 часа. Затем носителей выделяли еще раз и помещали на не подвергавшийся стрессу монослой Met-5A, стабильно экспрессирующий репортерную конструкцию dTomato-P2A-NanoLuciferase (AF34). Затем несвязанные шарики смывали и измеряли люминесценцию нанолюциферазы через 24 часа.Это представляет собой вторую независимую от стресса передающуюся адгезию.

    Эта процедура была продолжена аналогичным образом для третьей и четвертой передач подряд.

    Анализ силы отрыва клеток вращающегося диска

    Протокол, используемый для измерения силы отрыва клеток, был адаптирован из 36 . Вкратце, клетки Met-5A, стабильно экспрессирующие нанолюциферазу, высевали на предметные стекла, покрытые желатином (Sigma Aldrich, #G1393). Через 2 дня клетки подвергали стрессу, как описано выше, и выращивали еще в течение 24 часов.Затем предметные стекла переворачивали, лизировали и измеряли активность нанолюциферазы. Для исходных значений силы отрыва клеток выражали относительно значений нанолюциферазы, полученных из лизированного невращаемого предметного стекла, на котором клетки выращивали до слияния. Для отсоединения носителя от монослоя тот же протокол выполняли с монослоем клеток Met-5A, высеянным на покрытые желатином предметные стекла, на которые были добавлены покрытые Met-5A микроносители Cytodex® 3 (Sigma Aldrich, #C3275), стабильно экспрессирующие нанолюциферазу.Чтобы получить значимые значения с точки зрения генерируемых сил, использовались значения, как описано в таблице 1.1 36 , которая описывает взаимосвязь между скоростью вращения и напряжением сдвига стенки для диапазона радиальных положений поперек вращающегося диска (от оси вращения).

    Нокдаун, опосредованный миРНК

    Нокдаун, опосредованный РНКи, проводили в соответствии с протоколом трансфекции малой интерферирующей РНК (миРНК) производителя (Santa Cruz). Вкратце, мезотелиальные клетки трансфицировали указанными миРНК на 3-й день при совместном культивировании с микроносителями.Анализ адгезии in vitro проводили, как описано выше.

    Препарат мышиной ткани для визуализации

    После удаления органов органы фиксировали в течение ночи при 4 °C в 2% формальдегиде. На следующий день фиксированные ткани трижды промывали в фосфатно-солевом буфере Дульбекко (PBS) (DPBS, GIBCO, #14190-094) и, в зависимости от цели, заливали, замораживали в ОСТ-составе (Sakura, #4583) и хранили. при -20°C или при температуре 4°C в PBS, содержащем 0,2% желатина (Sigma Aldrich, #G1393), 0.5% Triton X-100 (Sigma Aldrich, #X100) и 0,01% тимеросал (Sigma Aldrich, #T8784) (PBS-GT).

    3D-визуализация цельных образцов ткани

    Цельные образцы были окрашены и очищены с использованием модифицированного протокола 3DISCO 37 . Короче говоря, образцы, хранящиеся в PBS-GT, инкубировали с первичными антителами в PBS-GT при встряхивании в течение 36 часов при комнатной температуре. Избыток антител удаляли тщательной промывкой в ​​PBS-GT в течение 6–12 ч и обновлением раствора каждые 1–2 ч. После инкубации со связанными с флуорофором вторичными антителами (Molecular Probes) в PBS-GT в течение 36 ч следует тщательная промывка в PBS-GT, как описано выше.При необходимости образцы обезвоживали в восходящей тетрагидрофурановой (Sigma, № 186562) серии (50 %, 70 %, 3 × 100 %; 60 мин каждая), а затем очищали в дихлорметане (Sigma, № 270997) в течение 30 мин и, наконец, погруженный в бензиловый эфир (Sigma, #108014). Неочищенные образцы визуализировали в чашках со стеклянным дном диаметром 35 мм (Ibidi, № 81218) с использованием лазерного сканирующего конфокального микроскопа (Zeiss LSM710) или многофотонного микроскопа SP8 (Leica). Очищенные образцы визуализировали при погружении в бензиловый эфир с помощью светового флуоресцентного микроскопа (LaVision BioTec).

    Трехмерная многофотонная визуализация

    Для многофотонной визуализации образцы заключали в 4% раствор агарозы NuSieve GTG (Lonza, #50080). Визуализация выполнялась с использованием 25-кратного погружаемого объектива (HC IRAPO L 25×/1,00 W), соединенного с перестраиваемым импульсным лазером (Spectra Physics, Insight DS+). Изображения с многофотонным возбуждением регистрировались с помощью внешних гибридных фотодетекторов без десканирования (HyD). Для обнаружения использовались следующие полосовые фильтры (BP): HC 405/150 BP для DAPI/Hoechst и генерации второй гармоники (SHG), ET 525/50 BP для зеленого канала, 585/40 BP для красного канала и 650/ 50 BP (пурпурный) для дальнего красного.Плитки были объединены с помощью набора приложений Leica Application Suite X (v3.3.0, Leica) с плавным смешиванием внахлест, а данные были визуализированы с помощью программного обеспечения Imaris (v9.1, Bitplane).

    3D визуализация световым листом

    Погруженные в бензиловый эфир образцы освещались с двух сторон планарным световым листом с использованием лазера белого света (SuperK Extreme EXW-9; NKT Photonics). EdU и PDPN возбуждались при 640/30 и 576/23 нм соответственно, а испускаемый свет регистрировался с использованием фильтров 690/50 и 620/31 нм.Оптические срезы записывали, перемещая камеру для образцов вертикально с шагом 5 мм через лазерный световой лист. Трехмерные реконструкции были получены с использованием программного обеспечения для обработки изображений Imaris (v9.1, Bitplane).

    Сканирующая электронная микроскопия

    Клетки Met-5A высевали на гранулы микроносителя Cytodex® 3 (Sigma Aldrich, #C3275) и подвергали шоковому обезвоживанию, как описано. Затем покрытые клетками шарики добавляли к клеткам Met-5A, высеянным на покрытые желатином (Sigma Aldrich, #G1393) предметные стекла, и после указанных временных точек предметные стекла фиксировали O/N при 4 °C с использованием 3% глутарового альдегида и 0.1% буфер какодилата натрия, pH 7,4 (Electron Microscopy Sciences, #16538). Что касается тканей животных, спайки индуцировали у мышей, как описано, и умерщвляли через 16 часов. Затем брюшину фиксировали таким же образом, как и образцы предметного стекла. Образцы были обезвожены в серийном разбавлении этанола и высушены методом критической точки с использованием CO 2 в качестве переходной жидкости (Polaron Critical-Point Dryer CPC E3000; Quorum Technologies, Ringmer, UK). Образцы напыляли слоем платины толщиной 7 нм с помощью распылительного устройства (Emitech K575; Quorum Technologies) и исследовали с помощью сканирующей электронной микроскопии (JSM 6300F; JEOL, Эхинг, Германия).

    Трехмерная конфокальная визуализация с отражением

    Изображения отражательной микроскопии были получены с помощью микроскопа Leica SP8 с использованием зеленого твердотельного лазера (552 нм). Конфокальные изображения были получены с точечным отверстием 44,7 мкм, а сигнал отражения был получен в диапазоне от 547 до 555 нм с использованием ФЭУ (Hamamatsu R 9624). Z -стеки (интервалы 1 мкм) регистрировались каждые 5 мин. Изображения обрабатывались с помощью LAS X (Leica; v3.6.0) и Imaris (Bitplane; v9.3.0), а яркость и контрастность настраивались для оптимальной визуализации.

    2D-визуализация срезов тканей мыши и человека

    Фиксированные ткани были залиты при оптимальной температуре резки (OCT) и вырезаны с помощью Microm HM 525 (Thermo Scientific). Для анализа использовались сагиттальные сечения 7 мкм. Короче говоря, срезы фиксировали в ледяном ацетоне в течение 5 минут при температуре -20 ° C, а затем промывали PBS. Затем срезы блокировали для неспецифического связывания 1% BSA и 5% козьей сыворотки в PBS в течение 60 мин при комнатной температуре, а затем инкубировали с первичными антителами в 1% BSA и 5% козьей сывороткой в ​​PBS, O/N при 4 °С.На следующий день после промывания срезы инкубировали в PBS с флуоресцентным вторичным антителом в течение 120 мин при комнатной температуре. Наконец, срезы промывали и инкубировали с красителем нуклеиновой кислоты Hoechst 33342 (Invitrogen, #h2399), промывали в ddH 2 O, заливали Fluoromount-G® (Southern Biotech, #0100-01) и хранили при 4 °C. во тьме.

    Трихромное окрашивание по Массону

    Для визуализации отложенного матрикса было выполнено трихромное окрашивание по Массону (Sigma Aldrich, #HT15). Вкратце, образцы фиксировали в течение 10 мин в ледяном ацетоне при температуре -20°С, а затем промывали в dH 2 O в течение 5 мин.Затем образцы инкубировали в течение ночи в растворе Буэна (Sigma Aldrich, #HT10132) при комнатной температуре, а на следующий день промывали под проточной водопроводной водой в течение 5 мин. Затем образцы погружали в раствор железистого гематоксилина Вейгерта (Sigma Aldrich, #HT1079) на 3 мин и снова промывали проточной водопроводной водой в течение 5 мин. Образцы инкубировали с раствором фуксина Briebrich Scarlet-Acid в течение 5 минут, промывали в dH 2 O и инкубировали с раствором фосфорно-вольфрамовой/фосфомолибденовой кислоты в течение 5 минут.Наконец, образцы погружали в раствор анилинового синего на 10 минут, промывали 1% уксусной кислотой в течение 2 минут, затем промывали dH 2 O, а затем обезвоживали в градиенте этанола. Затем образцы погружали 8–10 раз, очищали в Roti®-Histol (Carl Roth, #6640) и заливали Roti®-Histokitt (Carl Roth, #6638).

    Визуализация комплексов носитель-носитель, покрытых Met-5A

    Комплексы носитель-носитель, зафиксированные в 4% PFA в PBS в течение 20 мин при комнатной температуре. После этого комплексы дважды промывали PBS.Клетки пермеабилизировали в течение 10 мин в 0,1% Triton X-100 (Sigma Aldrich, #X100) в PBS при 4°C, после чего дважды промывали 0,02% Tween-20 (Sigma Aldrich, #9416) в PBS. Затем носители блокировали для неспецифического связывания с помощью 5% BSA и 0,02% Tween-20 в PBS в течение 60 мин при 4°C на качающейся платформе, а затем инкубировали с первичными антителами в 0,02% Tween-20 в PBS O/N. при 4 °С. На следующий день после промывания носители инкубировали в PBS с флуоресцентным вторичным антителом в течение 120 мин при 4°С на качающейся платформе.Наконец, носители промывали и инкубировали с красителем нуклеиновой кислоты Hoechst 33342 (Invitrogen, #h2399).

    Визуализация образцов Met-5A «носитель-монослой»

    Для образцов «носитель-монослой» Клетки Met-5A высевали на предметные стекла, покрытые желатином (Sigma Aldrich, #G1393). Образцы фиксировали 4% PFA в PBS в течение 20 минут при комнатной температуре. Клетки пермеабилизировали в течение 10 мин в 0,1% Triton X-100 (Sigma Aldrich, #X100) в PBS при 4°C, после чего дважды промывали 0,02% Tween-20 (Sigma Aldrich, #9416) в PBS.Затем предметные стекла блокировали для неспецифического связывания с помощью 5% BSA и 0,02% Tween-20 в PBS в течение 60 минут при 4°C, а затем инкубировали с первичным антителом в 0,02% Tween-20 в PBS O/N при 4°C. . На следующий день после отмывки носители инкубировали в PBS с флуоресцентными вторичными антителами в течение 120 мин при 4°С. Наконец, предметные стекла промывали и инкубировали с красителем нуклеиновой кислоты Hoechst 33342 (Invitrogen, #h2399).

    Мечение культур микроносителей и монослоев мембранным красителем

    Клетки Met-5A метили окрашивающим раствором DiO (Invitrogen, #V22886) в соответствии с инструкциями производителя и высевали в виде монослоя на стекло с покрытием из желатина (Sigma Aldrich, #G1393) палаты (Там же, #80287).Через 3 дня культивирования отдельную популяцию клеток высевали вместе с микроносителями Cytodex® 3 (Sigma Aldrich, #C3275) и метили с использованием набора PKh36 Red Fluorescent Cell Linker (Sigma Aldrich, #MINI26-1KT). Покрытые клетками шарики затем подвергали шоковому обезвоживанию, как описано, и добавляли к монослойной культуре.

    Маркировка микроносителей первичными мезотелиальными клетками

    Микроносители Cytodex3 окрашивали Alexa Fluor 488 NHS Ester (Thermo Scientific, #A20000) или Alexa Fluor 568 NHS Ester (Thermo Scientific, #A20003) в соответствии с инструкциями производителя.

    Предварительная обработка изображений

    Вся обработка и анализ изображений выполнялись с экспортированными изображениями Tif с использованием Fiji (ImageJ 2.0.0/1.52c, США). Флуоресцентные каналы были разделены, а яркость и контрастность отрегулированы для уменьшения фона, чтобы предотвратить ошибочную интерпретацию фона как клеточных структур на этапе сегментации.

    Предварительная обработка изображения: сегментация

    Анализ мезотелиального выпячивания был выполнен с использованием плагина Advanced weka segmentation Fiji 38 .Он использует набор алгоритмов машинного обучения для сегментации. В частности, сегментация на основе пикселей основана на функциях изображения, аннотированных к различным классам. Образцы пикселей были нарисованы бесплатно и отнесены к соответствующим классам, например, «филоподии», «тело клетки» или «фон». Последующие раунды обучения были выполнены для распределения соответствующих пикселей и структур по соответствующим классам для улучшения сегментации. Функции обучения, такие как «Размытие по Гауссу», «Фильтр Собеля», «Гессиан», «Разность гауссианов» и «Мембранные проекции», применялись вместе с классификатором по умолчанию «Быстрый случайный лес».Другие настройки были сохранены по умолчанию (толщина мембраны 1, размер участка мембраны 19, минимальное сигма 1,0 и максимальное сигма 16,0). Обученный классификатор и данные были сохранены для анализа других «нагруженных» и «ненапряженных» наборов мезотелиальных данных. Был написан макрос для автоматизации вышеуказанных шагов для других наборов данных с паузой в 5 с (функция ожидания (5000)) после каждого шага для плавной обработки. Изображения из сегментированных классов были извлечены и подвергнуты постобработке.

    Постобработка изображения: общая площадь поверхности филоподий

    Для количественного определения общей площади поверхности филоподий были получены сегменты филоподий, как описано в разделе «Сегментация».Яркость и контрастность были отрегулированы по этим изображениям и преобразованы в бинарные изображения. Затем рассчитывали среднюю интенсивность флуоресценции.

    Постобработка изображения: длина и ширина филоподий

    Длина и ширина филоподий были рассчитаны с использованием плагина ImageJ «Обнаружение гребня» 39 . Короче говоря, филоподиальные сегменты были получены, как описано в разделе «Сегментация». Были выбраны настройки «Исправить положение», «оценить ширину», «удлинить строку», «отобразить результаты» и «добавить в менеджер».Используемые параметры включали необязательные параметры (ширина линии: 10, высокая контрастность: 230, низкая контрастность: 87) и обязательные параметры (сигма: 3,39, нижний порог: 0,51, верхний порог: 1,19, минимальная длина строки: 15,00). Параметры были оптимизированы с использованием функции предварительного просмотра для одного набора данных, и аналогичные значения и настройки были применены для других наборов данных. Значения длины и ширины были извлечены из сводной вкладки и экспортированы в виде файла Excel.

    Маркировка EdU in vivo

    В день операции животным вводили внутрибрюшинно 1  мкг EdU (Invitrogen, № A10044), растворенного в 100 мкл PBS, и умерщвляли на 5-й день.После вырезания органа и фиксации в течение ночи в 2% формальдегиде EdU визуализировали с помощью набора для визуализации Click-iT™ EdU Alexa Fluor™ 647 (Invitrogen, #C10340) в соответствии с инструкциями производителя. Реакционный коктейль Click-iT® инкубировали с образцами в течение 36 часов при комнатной температуре, чтобы обеспечить достаточное проникновение в ткань. Затем ткани подвергали дальнейшей обработке в соответствии с протоколом визуализации цельного препарата (см. «3D-визуализация образцов ткани цельного препарата»).

    Местное лечение целлюлозой для местного применения

    Низкомолекулярные ингибиторы солюбилизировали в стерильной 2% гидроксиэтилцеллюлозе (Sigma Aldrich, #09368).Соединения добавляли непосредственно перед операцией и получали из маточного раствора 100–150 мМ, чтобы свести к минимуму конечное содержание ДМСО. Конечный раствор (200 мкл на 30 г массы тела) помещали между висцеральным и париетальным слоями поврежденной слепой кишки и брюшины соответственно.

    Животные

    Все эксперименты на животных проводились в соответствии со строгими государственными и европейскими директивами и были одобрены местными органами власти административного региона Верхняя Бавария в соответствии с лицензией № 55.2-1-54-2532-150-2015. Свободные от патогенов самцы и самки мышей C57BL/6 (возраст 6–10 недель) были получены из реки Чарльз и размещены группами в помещениях с контролируемым климатом с циклом свет/темнота 12 ч/12 ч. Животным давали пищу и воду вволю. В этом исследовании использовали мышей

    Rosa26 mTmG или Rosa26 tm1(DTA)Lky , скрещенных с Procr CreERT2-IRES-tdTomato (Jackson Laboratories). Для экспериментов по отслеживанию линий, индуцированных у взрослых мышей в возрасте 6–8 недель, животные получали три внутрибрюшинные инъекции (Z)-4-гидротамоксифена (Sigma Aldrich, #H7904, 2 мг на 25 г массы тела, разведенного в 100 мкл кукурузного масла (Sigma Aldrich). Aldrich, #C8267)) через день, чтобы вызвать активацию рекомбиназы Cre.Для селективной абляции мезотелиальных клеток PROCR+ животным однократно вводили (Z)-4-гидротамоксифен (Sigma Aldrich, #H7904, 2 мг на 25 г массы тела, разведенный в 100 мкл кукурузного масла (Sigma Aldrich, #C8267)) сразу после операции перед закрытием живота.

    Модель адгезии на мышах

    Мышей анестезировали внутрибрюшинной инъекцией смеси медетомидина (500 мкг/кг), мидазолама (5 мкг/кг) и фентанила (50 мкг/кг), далее именуемой ММФ. Мониторинг глубины анестезии оценивали по пальцевому рефлексу.Глаза покрывали бепантеном, чтобы избежать обезвоживания, а живот выбривали и дезинфицировали бетадином и стерильным PBS. Животных держали на спине на нагревательной пластине при 37 °С. Выполняли срединную лапаротомию (1-1,5 см) через кожу и брюшину. Четыре крючка, расположенные вокруг разреза и прикрепленные к ретрактору и магнитной опорной пластине, обеспечили свободный доступ к брюшной полости. Небольшой хирургической щеткой аккуратно отшлифовали поверхность брюшины и прилегающую к ней поверхность слепой кишки.Затем через серозную поверхность брюшины накладывали два хирургических узла с использованием шелковых швов 4-0 (Ethicon). Ватным тампоном осторожно наносили мазок талька (Sigma Aldrich, № 243604) на поврежденные поверхности. Перед закрытием разреза в брюшную полость пипеткой вводили бупренорфин (0,1 мг/кг), чтобы обеспечить начальную послеоперационную анальгезию. Для длительного обезболивания вводили метамизол (новальгин, 200 мг/кг) в виде ежедневных инъекций. Брюшину и кожу зашивали двумя отдельными швами из шелка 4-0 (Ethicon).После закрытия разреза мышей будили путем противодействия раствору ММФ посредством подкожной инъекции смеси атипамезола (1 мг/кг) и флумазенила (0,25 мг/кг). Мышам давали выздороветь на грелке, после чего их содержали вместе (самки) или по отдельности (самцы) и наблюдали в течение 1–5 дней. Спайки оценивали по грубым морфологическим признакам, указывающим на развитие спаек. Были оценены пять отдельных характеристик адгезии (см. Дополнительную таблицу 1), которые вместе дали совокупное значение, которое определило общую оценку адгезии.С помощью этой системы полное отсутствие спаек оценивалось как 0, в то время как максимальное количество спаек равнялось 15.

    Человеческая ткань

    Все человеческие образцы были получены во время операции в отделении хирургии, Klinikum rechts der Isar, Технический университет Мюнхена. , после одобрения местным комитетом по этике Технического университета Мюнхена, Германия (№ 173/18 S). Спайки были интраоперационно диагностированы и выделены из соответствующих органов и подготовлены для дальнейшего анализа.Информированное согласие было получено от всех субъектов после операции.

    Секвенирование одноклеточной РНК (Drop-seq)

    Клетки Met-5A выращивали в культуре и подвергали стрессу в течение 15 минут путем высушивания. Затем в указанные моменты времени образцы инкубировали в течение 5 мин в растворе трипсин-ЭДТА при 37°С. Трипсин инактивировали охлажденной льдом средой для анализа, и клетки дважды промывали охлажденным льдом PBS. Эксперименты Drop-seq проводились, как описано ранее 20,21 , с небольшими адаптациями во время подготовки одноклеточной библиотеки.Вкратце, отдельные клетки разводили в PBS с добавлением 0,04% бычьего сывороточного альбумина до конечной концентрации 100 клеток/мкл. Используя микрожидкостное устройство PDMS (Nanoshift), отдельные клетки совместно инкапсулировали в капли с шариками со штрих-кодом (Chemgenes Corporation, Уилмингтон, Массачусетс) при конечной концентрации 120 шариков/мкл. Капли собирали в течение 15 мин/образец. После разрыва капель гранулы собирали, промывали и готовили для обратной транскрипции мРНК на гранулах (Maxima RT, Thermo Fisher).После обработки экзонуклеазой I (New England Biolabs) для удаления неиспользованных праймеров гранулы подсчитывали, делили на аликвоты (2000 гранул/реакцию, что составляет ~100 клеток/реакцию) и предварительно амплифицировали с помощью 13 циклов ПЦР (праймеры, химия и условия цикла идентичны ранее описанным в Macosko et al., 20 ). Продукты ПЦР объединяли и дважды очищали с использованием очищающих гранул 0,6x (CleanNA). Перед маркировкой образцы кДНК загружали на высокочувствительный ДНК-чип биоанализатора 2100 (Agilent) для обеспечения целостности, чистоты и количества транскриптов.Для каждого образца 1 нг предварительно амплифицированной кДНК из примерно 1000 клеток был помечен с помощью Nextera XT (Illumina) с помощью специального праймера P5 (Integrated DNA Technologies). Библиотеки одиночных клеток секвенировали в парном цикле длиной 100 п.н. на Illumina HiSeq4000 с использованием 0,2 нМ денатурированного образца и 5% добавлением PhiX. Для праймирования чтения 1 использовали 0,5 мкМ Read1CustSeqB (последовательность праймера: GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC).

    Биоинформационная обработка данных секвенирования одноклеточной РНК

    Основной вычислительный конвейер Drop-seq использовался для обработки считываний секвенирования следующего поколения данных scRNA-seq, как описано ранее 20 .Вкратце, STAR (версия 2.5.2a) использовался для сопоставления 40 . Чтения были приведены в соответствие со ссылкой на геном hg19 (предоставленной группой Drop-seq, GSE63269). Для фильтрации штрих-кодов мы исключили штрих-коды с менее чем 200 обнаруженными генами. Высокая доля (> 10%) количества транскриптов, полученных из генов, кодируемых митохондриями, может указывать на низкое качество клеток, и мы удалили эти неквалифицированные клетки из последующего анализа. После получения матрицы данных DGE мы использовали Seurat для уменьшения размеров, кластеризации и дифференциального анализа экспрессии генов 20 .

    Анализ главных компонентов

    Используя только вариабельные гены, был проведен анализ главных компонентов (PCA). Первые 15 основных компонентов использовались в качестве входных данных для функции Seurat FindClusters с разрешением 0,5. Этот метод выполняет кластеризацию ячеек, встраивая их в графоподобную структуру. Используется граф k ближайших соседей, в котором любые две ячейки (представленные в виде узлов), соединенные ребром, имеют вес ребра, который находится среди k наименьших расстояний от первого узла до любого другого.Таким образом, между клетками с похожими паттернами экспрессии генов рисуются границы. Методы оптимизации модульности, такие как алгоритм Лувена, пытаются выявить части графа с разной связностью и, следовательно, разделить граф на отдельные взаимосвязанные модули.

    Метод абстракции графа на основе разделов

    Для визуализации результата кластеризации многомерных одноячеечных данных был использован алгоритм Фрухтермана-Рейнгольда из инструментария Python Scanpy 41 .Кроме того, для отображения связи между группами ячеек использовался метод абстракции графа на основе разделов (PAGA) 41 . Клетки были сгруппированы в соответствии с моментом времени экстракции. На графике эти группы представлены в виде узлов, а ребра между узлами показывают связность или родство этих групп, таким образом определяя их сходство в отношении различий в экспрессии генов.

    Анализ путей с временным разрешением

    Для прогнозирования активности путей и клеточных функций на основе наблюдаемых изменений экспрессии генов мы использовали платформу Ingenuity® Pathway Analysis (IPA®, QIAGEN Redwood City, www.qiagen.com/ingenuity), как описано выше 42 . В анализе используется набор алгоритмов и инструментов, встроенных в IPA, для вывода и оценки регуляторных сетей, предшествующих данным об экспрессии генов, на основе крупномасштабной причинно-следственной сети, полученной из базы знаний Ingenuity. Используя «Анализ последующих эффектов» 43 , встроенный в IPA, мы стремились идентифицировать те биологические процессы и функции, которые, вероятно, будут причинно затронуты активируемыми и подавляющими генами в наборе данных транскриптомики отдельных клеток.В нашем анализе мы считали гены со значением перекрытия P >7 (log10), которые имели активацию Z -оценка >2, как активированные, а гены с активацией Z -оценка < −2 — как ингибированные.

    Статистика и воспроизводимость

    Все данные представляют собой среднее  ± SEM. Критерий Шапиро-Уилка ( p  > 0,05), а также визуальная проверка соответствующих гистограмм, нормальных графиков Q-Q и коробчатых диаграмм использовались для проверки нормального распределения выборок (приблизительно) с использованием IBM SPSS Statistics версии 23.Сравнение двух групп было проведено с использованием непарного критерия Стьюдента t для нормально распределенных данных или критерия Манна-Уитни U в качестве непараметрического эквивалента. Сравнения между тремя или более группами были выполнены с использованием однофакторного дисперсионного анализа с последующим апостериорным тестом Тьюки для данных с нормальным распределением или с тестом Крускала-Уоллиса H для данных с ненормальным распределением. Значение p  < 0,05 считалось статистически значимым, где * p  < 0.05, ** p  < 0,01 и *** p  < 0,001. Анализы проводились с помощью GraphPad Prism версии 6 (GraphPad Software, Inc.). График направленности / полярных координат был выполнен с использованием библиотеки «ggplot2» № 1234 в R № 5678 версии 3.4.1, 2 44,45 . Все эксперименты были повторены не менее трех раз независимо друг от друга с аналогичными результатами.

    Сводка отчета

    Дополнительная информация о дизайне исследования доступна в Сводке отчета об исследовании природы, связанной с этой статьей.

    The Salinas Californian

    Доктор Энтони Л. Комарофф | Visalia

    D УХОВРАЧ K: В прошлом году мне сделали операцию на брюшной полости. Вскоре после этого у меня начались сильные боли и вздутие живота. Оказывается, у меня спайки в животе. Я никогда о них не слышал. Что это такое и как их лечить?

    УВАЖАЕМЫЙ ЧИТАТЕЛЬ! Абдоминальные спайки представляют собой полосы фиброзной рубцовой ткани. Они могут привести к тому, что органы, которые в норме не соединены, прилипают друг к другу или к стенке брюшной полости.

    Абдоминальные спайки чаще всего развиваются после операций на органах брюшной полости. Реже спайки образуются у людей, у которых развивается инфекция или другой тип воспаления в брюшной полости.

    У большинства пациентов спайки не вызывают никаких симптомов. Однако у небольшого числа людей они есть. Некоторые люди наследуют гены, повышающие вероятность образования спаек. Некоторым просто не повезло: спайки образуются в местах, где они с большей вероятностью сдавливают и блокируют кишечник.

    В любом случае фиброзные тяжи рубцовой ткани могут полностью или частично блокировать кишечник.Эта закупорка называется непроходимостью кишечника. Это может вызвать схваткообразную боль в животе. Иногда участок кишечника то блокируется, то разблокируется. В результате симптомы приходят и уходят.

    Более выраженная кишечная непроходимость может вызвать:

    • сильную спастическую боль в животе;

    • тошнота и рвота;

    • вздутие живота;

    • неспособность отходить от газов и отсутствие или редкость дефекации;

    • признаки обезвоживания.К ним относятся сухость кожи, сухость во рту и языке, сильная жажда, нечастое мочеиспускание, учащенное сердцебиение и низкое кровяное давление.

    В редких случаях часть кишечника туго закручивается вокруг полосы спаек. Это прерывает нормальное кровоснабжение искривленной кишки, вызывая «удушение». Этот участок кишечника начинает отмирать. Когда возникает такая неотложная ситуация, требуется немедленная операция на брюшной полости для удаления спаек и восстановления кровотока в кишечнике.

    Во время операции хирург удаляет как можно больше рубцовой ткани, вызывающей закупорку.При проведении операции хирург часто замечает другие спайки, кроме тех, которые вызывают закупорку. Пациент уже находится под наркозом, и брюшная полость вскрыта. Поэтому удаляются и другие спайки, чтобы они не вызывали проблем в будущем. (Я поместил иллюстрацию операции по удалению спаек на своем веб-сайте AskDoctorK.com.)

    Таким образом, операция является одновременно и причиной спаек брюшной полости, и средством их лечения. Когда проводится операция по устранению кишечной непроходимости, вызванной спайками, операция может вызвать повторное образование спаек и создать новую непроходимость.Лапароскопическая хирургия, при которой делается несколько небольших разрезов вместо одного большого разреза, может снизить риск образования спаек в брюшной полости.

    Таким образом, решение хирурга о проведении операции может быть сложным. Однако, когда спайки вызывают странгуляцию, это несложно: хирургическое вмешательство не только необходимо, но и часто спасает жизнь.

    Доктор Комарофф — врач и профессор Гарвардской медицинской школы. Чтобы отправить вопросы, перейдите на сайт AskDoctorK.com или напишите: Ask Doctor K, 10 Shattuck St., Second Floor, Boston, MA 02115.

    Что нужно знать при проведении адгезиолизиса для удаления спаек брюшной полости и таза

    Адгезиолизис — это хирургическая процедура, которая проводится для удаления спаек, образовавшихся в организме. Операция позволяет восстановить нормальные функции органов.

    Когда вам нужна операция по адгезиолизису?

    Спайка представляет собой полосу рубцовой ткани, которая обычно образуется в определенной области, когда в организме запускается механизм восстановления.Спайки образуются после любого повреждения ткани, такого как операция, инфекция или травма.

    В некоторых случаях спайки образуются в избытке и могут сдавливать органы человека, вызывая боль и дискомфорт. Когда избыточная рубцовая ткань нарушает нормальное функционирование органов, необходимо рассмотреть возможность проведения адгезиолизиса.

    Операция должна быть проведена для облегчения очень тяжелых и опасных для жизни симптомов, таких как возможная потеря функции органа или кишечная непроходимость. Пригодность пациента к операции должна оцениваться в каждом конкретном случае.

    Симптомы, помогающие идентифицировать спайки

    Определить наличие нежелательных спаек в организме может быть сложно, так как у пациентов почти не наблюдается никаких симптомов. Однако в тяжелых случаях спайки могут вызывать сильную боль в пораженном органе. Другие симптомы могут также включать общую тазовую боль, непроходимость кишечника, боль при глубоком вдохе и снижение фертильности.

    Абдоминальные или тазовые спайки

    Абдоминальные спайки обычно образуются после операций на органах брюшной полости, в то время как тазовые спайки могут проявляться после гинекологических операций или воспалительных заболеваний органов малого таза (ВЗОМТ).

    Что вызывает спайки в брюшной полости или тазу?

    1. Абдоминальная или тазовая хирургия

    Операция по удалению аппендикса или желчного пузыря, разрешение внематочной беременности или любая обширная операция на органах малого таза или брюшной полости может привести к образованию спаек.

    2. Воспаление

    Воспалительные состояния, такие как болезнь Крона, аппендицит или язвенный колит, могут привести к образованию спаек.

    3. Инфекция

    Бактериальная инфекция при болезни Крона может привести к образованию абсцессов в стенке кишечника или вокруг нее, а также вокруг заднего прохода или прямой кишки.При заживлении этих абсцессов в кишечнике могут образовываться спайки.

    4. Заболевания, передающиеся половым путем (ЗППП)

    Спайки в матке, фаллопиевых трубах и вокруг яичников могут вызывать образование спаек. Эти спайки могут привести к нерегулярным менструальным циклам, бесплодию или хроническим тазовым болям.

    Другие причины

    Некоторыми другими причинами образования спаек могут быть внутренние брюшные кровотечения, наличие инородных тел в брюшной полости, лучевая или химиотерапия по Бодмину все или рак малого таза.

    Лечение спаек с помощью адгезиолиза

    Спайки можно удалить хирургическим путем с помощью процедуры, называемой адгезиолизисом. Хирургическая процедура может быть выполнена во время лапароскопии или открытой операции, называемой лапаротомией. Вы можете ожидать, что операция по адгезиолизису займет от двух до четырех часов.

    Как найти врача для операции?

    Если вы планируете операцию по адгезиолизису, вам следует проконсультироваться с практикующим врачом, имеющим опыт лечения абдоминальных или тазовых заболеваний.Потратив время на исследование и выбор правильного врача, вы сможете обеспечить наилучший конечный результат.

    Пациент может быть выписан из больницы в течение 24 часов после успешного завершения операции по адгезиолизису. Ожидается, что период восстановления продлится около нескольких недель.

    Свяжитесь с нашим офисом

    Доктора Джон Миклош и Роберт Мур могут помочь вам определить, подходит ли вам операция по адгезиолизису. Если вы хотите узнать больше о лечении, свяжитесь с нашим офисом сегодня, чтобы назначить консультацию.

    Спайки в брюшной полости, хирургия, лечение | Наффилд Здоровье

    Что такое абдоминальная спаечная хирургия?

    Во многих случаях спайки остаются незамеченными. Однако, если вы перенесли абдоминальную операцию, вокруг кишечника могут образоваться спайки, вызывающие ограничение и дискомфорт. Серьезные спайки могут вызвать полную непроходимость кишечника, что требует неотложной медицинской помощи.

    У женщин абдоминальные спайки могут вызвать проблемы с фертильностью.

    Подходит ли мне операция на брюшной полости?

    Если вы испытываете боль в животе и вздутие живота в течение длительного периода времени, вам следует обратиться к врачу.Ваш лечащий врач может назначить обезболивающее и диету, чтобы облегчить работу кишечника. Если ваш дискомфорт не уменьшается с помощью консервативного лечения, вас могут направить к консультанту для операции по расщеплению спаек.

    Что происходит во время операции на брюшной полости?

    Адгезионная хирургия обычно проводится под общей анестезией. Обычно это делается как «хирургия замочной скважины». Ваш хирург сделает несколько небольших надрезов (надрезов) на животе. Они вставят специальные хирургические инструменты и тонкую трубку с камерой и источником света для осмотра и удаления спаек.В некоторых случаях они могут оставить лекарство в животе, чтобы предотвратить дальнейшие спайки. Ваши раны будут закрыты с помощью швов или скоб.

    Возможно, вам придется остаться в больнице на 1-2 дня. Более длительное пребывание может потребоваться, если ваши спайки вызвали какое-либо повреждение ваших органов.

    Восстановление после операции на брюшной полости

    Продолжайте принимать любые болеутоляющие препараты в соответствии с предписаниями. Вы должны избегать подъема тяжестей или напряженной деятельности в течение примерно 4 недель. Восстановление после абдоминальной спаечной хирургии будет зависеть от вашей медицинской ситуации.

    Обязательно и обсудите любое возвращение к работе со своим консультантом.

    Наша команда специалистов-физиотерапевтов обеспечит квалифицированное лечение, реабилитацию и консультации во время вашего пребывания в больнице и, при необходимости, последующее амбулаторное наблюдение для поддержки вашего полного выздоровления.

    Лизис спаек — Больница и медицинский центр Лахи, Берлингтон и Пибоди

    Шеннон Д.В.

    (Разрезание спаек; Адгезиолизис)

    Определение

    Спайки — это рубцы, которые образуются внутри тела.Обычно они образуются в области живота или таза. Они также могут образовываться в суставах или глазах. Спайки развиваются естественным образом после операции как часть процесса заживления. Они также могут развиваться после инфекции или любого другого воспалительного процесса, такого как:

    Лизис спаек – это процесс разрезания рубцовой ткани в организме. Это делается для восстановления нормальной функции и уменьшения боли.

    Лапароскопическая хирургия спаек кишечника
    Copyright © Nucleus Medical Media, Inc.

    Причины процедуры

    Спайки могут вызывать:

    • Боль
    • Непроходимость кишечника
    • Бесплодие
    • Диапазон ограничения движения

    Эта операция устраняет непроходимость кишечника и лечит бесплодие, вызванное спайками. Это также уменьшает хроническую боль в животе у некоторых людей.

    Возможные осложнения

    Проблемы из-за процедуры возникают редко, но все процедуры сопряжены с определенным риском.Ваш врач рассмотрит возможные проблемы, такие как:

    • Травмы органов или суставов
    • Хуже спаек
    • Кровотечение
    • Инфекция
    • Грыжа

    Перед процедурой поговорите со своим врачом о способах управления факторами, которые могут увеличить риск осложнений, таких как:

    Чего ожидать

    До процедуры

    Ваш врач проведет медицинский осмотр и может назначить некоторые из следующих тестов:

    • Анализы крови и мочи
    • Тесты визуализации будут использоваться для поиска спаек и осложнений от них:

    Перед операцией:

    • Поговорите со своим врачом о ваших лекарствах.Вас могут попросить прекратить прием некоторых лекарств за неделю до процедуры.
    • Организовать поездку домой из больницы. Кроме того, попросите кого-нибудь помочь вам по дому.
    • Съешьте легкую пищу накануне операции. Не ешьте и не пейте ничего после полуночи.

    Описание процедуры

    Обычно эту операцию делают лапароскопически .

    Абдоминальные спайки
    • В брюшной полости будут сделаны небольшие отверстия для доступа к пораженным органам.Газ используется для расширения живота, чтобы хирургу было легче видеть. Лапароскоп будет вставлен через маленькие отверстия. Трубки со светом и камерой проецируют изображения на экран. После обнаружения спайки вырезаются небольшими хирургическими инструментами, которые вводятся через трубки. Это освободит органы, которые были захвачены спайками.

    В некоторых случаях врачу может потребоваться перейти к открытой хирургии брюшной полости или провести ее. В брюшной полости будет сделан больший разрез.Это позволит получить прямой доступ ко всем органам. Спайки будут вырезаны.

    Спайки суставов
    • Когда вы спите, лапароскоп вводят через небольшое отверстие, прорезанное в коже. Район будет осмотрен. Вокруг сустава будет сделано несколько небольших надрезов. С помощью небольших инструментов, которые вводятся через эти отверстия, спайки будут вырезаться. Это освободит спайки, ограничивающие функцию сустава.

    Сколько времени это займет?

    1-3 часа

    Насколько это будет больно?

    Анестезия предотвратит боль во время операции.С болью и дискомфортом после процедуры можно справиться с помощью лекарств.

    Среднее пребывание в больнице

    Эта операция проводится в условиях стационара. Если у вас лапароскопическая операция, вы сможете уйти в тот же или на следующий день. Если у вас открытая операция, вам нужно будет остаться в больнице на несколько дней. Возможно, вам придется остаться дольше, если у вас есть осложнения.

    Постпроцедурный уход

    Предотвращение инфекции

    Во время вашего пребывания персонал больницы предпримет следующие шаги, чтобы снизить вероятность заражения, например:

    • Моют руки
    • Ношение перчаток или масок
    • Защита разрезов

    Существуют также меры, которые можно предпринять для снижения вероятности заражения, например:

    • Часто мыть руки и напоминать своим лечащим врачам делать то же самое
    • Напоминание поставщикам медицинских услуг о необходимости носить перчатки или маски
    • Не позволяйте другим прикасаться к вашему разрезу
    Дома

    Некоторые виды деятельности будут ограничены до полного заживления разрезов.Обязательно следуйте инструкциям своего врача по уходу за разрезом, чтобы предотвратить инфекцию.

    Позвоните своему врачу

    Позвоните своему врачу, если произойдет что-либо из перечисленного:

    • Признаки инфекции, включая лихорадку и озноб
    • Покраснение, отек, усиливающаяся боль, обильное кровотечение или выделения из места разреза
    • Боль, которую вы не можете контролировать с помощью лекарств, которые вам дали
    • Постоянная тошнота или рвота
    • Диарея, запор, кровавый или черный стул
    • Вздутие живота
    • Усиливающаяся боль в суставах или отек
    • Проблемы с мочеиспусканием
    • Кашель, одышка или боль в груди

    Если вы считаете, что у вас неотложная помощь, немедленно позвоните в службу неотложной медицинской помощи.

    Ссылки

    Адгезия. Сайт горы Синай. Доступно по адресу: http://www.mountsinai.org/health-library/diseases-conditions/adhesion. Обновлено 5 апреля 2016 г. По состоянию на 10 января 2018 г.

    Dunker MS, Bemelman WA, Vijn, et al. Отдаленные результаты и качество жизни после лапароскопического адгезиолизиса по поводу хронической боли в животе. J Am Assoc Gynecol Laparosc. 2004;11(1):36-41.

    Устранение кишечной непроходимости. Сайт энциклопедии хирургии. Доступно по адресу: http://www.surgeryencyclopedia.com/Fi-La/Intestinal-Obstruction-Repair.html. По состоянию на 10 января 2018 г.

    Ламву Г., Ту Ф., Ас-Сани С., Золнун Д., Стидж Дж. Ф. Роль лапароскопии в диагностике и лечении состояний, связанных с хронической тазовой болью. Obstet Gynecol Clin N Am. 2004;31(3):619-630.

    Сомштайн С., Ло Мензо Э., Симпфендорфер С., Цундель Н., Розенталь Р.Дж. Лапароскопический лизис спаек. Мир J Surg. 2006;30(4):535-540.

    Информация о версии

    • Рецензент: Медицинский наблюдательный совет EBSCO Даус Манке, доктор медицины
    • Дата проверки: 11/2018
    • Дата обновления: 20.12.2014

    Контроль спаек в брюшной полости — ScienceDaily

    Шрамы внутри брюшной полости, известные как спайки, образуются после воспаления или операции.Они могут вызывать хроническую боль и проблемы с пищеварением, приводить к бесплодию у женщин или даже иметь потенциально опасные для жизни последствия, такие как кишечная непроходимость. Если спайки разовьются, их придется оперировать снова. Они также затрудняют последующие оперативные вмешательства. Это приводит к значительным страданиям пострадавших, а также является значительным финансовым бременем для системы здравоохранения. Только в США спайки в брюшной полости приводят к расходам на здравоохранение в размере 2,3 миллиарда долларов в год.

    Знания о причине спаек до сих пор неполны, а лечения от них нет. «Поскольку это заболевание в значительной степени упускалось из виду в исследованиях, мы начали эту программу в Берне, чтобы узнать больше о развитии спаек», — говорит Даниэль Кандинас, соавтор этого исследования. Уже предполагалось, что решающую роль в развитии играют особые иммунные клетки, называемые макрофагами. Это подтвердили Джоэл Зиндел и Даниэль Кандинас из отделения висцеральной хирургии и медицины Инзельшпиталя и отделения биомедицинских исследований (DBMR) Бернского университета.

    Затем Зиндель продолжил свои исследования в Университете Калгари в Канаде в группе под руководством Пола Кубеса, так как они считаются ведущими в мире в области макрофагов в брюшной полости. Благодаря клиническому опыту Зиндела и ноу-хау канадских исследователей стало возможным разработать новую систему визуализации с использованием передовой микроскопии, которая позволяет заглянуть внутрь живого организма. Это позволило им поймать макрофаги на месте и на пленку, поскольку они образуют формы, которые затем приводят к спайкам.

    Исследователи также смогли описать молекулярные механизмы, лежащие в основе этого. Результаты исследования опубликованы на обложке журнала Science .

    Разработана новая технология

    Макрофаги находятся в так называемой перитонеальной жидкости, смазке между брюшиной, которая является внутренней оболочкой брюшной стенки, и аналогичной оболочкой вокруг органов в брюшной полости. Макрофаги пассивно плавают в этой жидкости, подобно планктону в море.В их задачи входит устранение болезнетворных микроорганизмов, а также максимально быстрое заживление повреждений в брюшной полости.

    Каким образом они совершают последнее, т. е. распознают повреждение и перемещаются туда, было неясно до сих пор. Поскольку эти клетки ведут себя в пробирке совершенно иначе, чем в организме, Зиндел и Кубес разработали новую технику микроскопии, которая позволила им использовать самую тонкую часть брюшной стенки в качестве окна для наблюдения за брюшной полостью. «естественную среду обитания» этих макрофагов и снимите их на видео, как они перемещаются вокруг.

    Когда макрофаги теряют контроль

    При повреждении брюшной полости макрофаги агрегируют в течение нескольких минут, образуя структуры, похожие на сгустки. Таким образом, они закрывают рану. Как обнаружили исследователи во главе с Зинделем и Кубесом, молекулярный механизм, стоящий за этим, основан на особых неспецифических рецепторах, которые распознают различные структуры. Просто перемещаясь через жидкость через дыхательные или пищеварительные движения, эти рецепторы действуют, чтобы инициировать свертывание крови вокруг раны.Однако то, что хорошо работает при небольших травмах, становится проблемой при больших, таких как хирургическое вскрытие брюшной стенки или установка имплантата. «При более крупных травмах макрофаги выходят из-под контроля — сгустки не перестают расти и образуют длинные нити», — объясняет Зиндел. «Мы смогли показать, что именно эти нити приводят к спайкам».

    У этого могут быть эволюционные причины: макрофаги оптимизированы эволюцией, чтобы хорошо справляться с небольшими повреждениями. «Давайте возьмем в качестве примера охотника, раненного оленьим рогом, — говорит Зиндель.«Макрофаги запечатывают все внутренние отверстия как можно быстрее — это единственный способ выжить». Однако, когда воздух попадает в брюшную полость во время абдоминальной операции или имплантируются инородные тела, макрофаги переполняются, потому что эволюция не подготовила их к этому вызову. «В этом случае макрофаги становятся вредными и вызывают спайки», — объясняет Зиндел.

    Патент заявлен

    Исследователи обнаружили, что когда соответствующие рецепторы блокируются у мышей, это приводит к меньшему количеству спаек.Таким образом, была подана патентная заявка на использование активного ингредиента против спаек. Полученные данные актуальны для многих областей исследований, поскольку нет других иммунных клеток, которые рекрутируются так быстро, как макрофаги в брюшной полости. Подобные механизмы могут присутствовать и в других полостях, таких как сердце или легкие, или могут играть роль не только в травмах, но и в таких заболеваниях, как опухоли брюшной полости.

    «Это пример того, как лабораторные исследования имеют высокую трансляционную ценность», — говорит Даниэль Кандинас.Вместе с Калгари бернские исследователи теперь будут искать партнеров в отрасли и надеются, что смогут подтвердить эффективность соединения и в тканях человека. В будущем пациентам можно было бы, например, давать перед операцией препарат, подавляющий макрофагальную реакцию и тормозящий образование спаек.

    Пеория, Аризона: Центр малоинвазивной и роботизированной хирургии: малоинвазивная и роботизированная хирургия

    Что такое спайки?

    Спайки — это полосы рубцовой ткани, которые образуются внутри брюшной полости или в верхней части кишечника.Ткань развивается между вашими органами, заставляя их слипаться или прикрепляться к брюшной стенке.

    Когда эти структуры застревают, движения могут вызывать сильную боль в животе. Спайки также могут привести к другим осложнениям со здоровьем, таким как кишечная непроходимость, которая может стать опасной для жизни.

    Во многих случаях у людей, перенесших открытые операции на брюшной полости или кишечнике, чаще возникают абдоминальные или кишечные спайки. У вас также могут развиться спайки, если у вас есть такие состояния, как дивертикулит или болезнь Крона, которые вызывают хроническое воспаление в брюшной полости.

    Каковы симптомы абдоминальных спаек?

    У вас могут быть абдоминальные или кишечные спайки без каких-либо симптомов. Однако скручивающие и тянущие движения могут вызывать боль, которая со временем может усиливаться. Другие распространенные симптомы спаек включают:

    • Тошнота
    • Вздутие живота
    • Рвота
    • Запор

    воспаление слизистой оболочки брюшной стенки, вызывающее хроническую боль.Вы также можете заметить, что из-за кишечной непроходимости у вас не выходит газ.

    Как диагностируются спайки?

    Если вы испытываете симптомы спаек, которые не проходят сами по себе или ухудшаются со временем, квалифицированные хирурги Центра малоинвазивной и роботизированной хирургии могут провести медицинский осмотр, чтобы подтвердить наличие спаек или выявить другие причины ваших симптомов.

    Визуализирующие исследования также являются частью диагностического процесса, и ваш хирург может запросить УЗИ или компьютерную томографию во время обследования.

    Нужна ли операция по поводу спаек?

    Если у вас есть спайки, которые не вызывают боли или других проблем, скорее всего, операция вам не понадобится. Однако, если абдоминальные или кишечные спайки влияют на ваше здоровье, хирурги CMIRS могут провести операцию по удалению спаек с использованием минимально инвазивных или роботизированных методов.

    Если у вас возникли осложнения, такие как кишечная непроходимость в результате спаек, вам следует немедленно обратиться за лечением.