29Авг

Диетический стол 5п: Страница не найдена

Содержание

Диетический стол № 5П (II)

Диетический стол № 5П (II)

Диетический стол № 5П (II) Диета № 5П (II) направлена на предотвращение рецидивов и развития панкреатита. Назначается на несколько месяцев после диеты № 5П (I).

Показания к диетическому столу № 5П (II)

Диета № 5П (II) показана при остром панкреатите в стадии затухания, при хроническом панкреатите в стадии нерезкого обострения, при хроническом панкреатите в стадии ремиссии.

Цель диетического стола № 5П (II)

Целью диеты № 5П (II) является предотвращение рецидивов и развития болезни, восстановление нарушенного обмена веществ.

Общая характеристика диетического стола № 5П (II)

Диета № 5П (II) характеризуется повышенным содержанием белков при умеренном ограничении легкоусваиваемых углеводов и соли.
Диета умеренно щадящая, предусматривает ограничение экстрактивных веществ и грубой клетчатки. Пищу готовят на пару, в отварном виде, запекают, тушат. Всю пищу желательно измельчать, протирать при необходимости. Диета № 5П (II) предусматривает дробный режим приема пищи 5–6 раз в день строго небольшими порциями.

Диета назначается на 2–3 месяца после диеты № 5П (I). При ухудшении состояния пациента на диете № 5П (II) необходимо вернуться к предыдущему столу.

Химический состав и энергоценность диетического стола № 5П (II)

Белки: 110–120 г (в том числе до 50 г белков животного происхождения).
Жиры: 80–90 г (в том числе 1/3 количества – растительные жиры).
Углеводы:

250–350 г (в том числе до 40 г простых углеводов).
Суточная калорийность: 2 100 – 2 700 ккал.
Свободная жидкость: 1,5–2 л.
Поваренная соль: 6–8 г.
Витамины: ретинол (А) – 0,4 мг, бета-каротин – 13 мг, рибофлавин (В2) – 2,6 мг, тиамин (В1) – 1,3 мг, никотиновая кислота (В3) – 17 мг, аскорбиновая кислота (С) – 250 мг.
Макроэлементы: натрий – 4 г, кальций – 1,3 г, магний – 0,5 г, фосфор – 1,9 г.
Микроэлементы: железо – 35 мг.
Оптимальная температура блюд: от 15 до 60 градусов Цельсия.

Рекомендуемые продукты и блюда диетического стола № 5П (II)

Хлеб: пшеничные сухари, вчерашний и подсушенный пшеничный хлеб.
Супы: слизистые крупяные супы на овощном отваре или воде, овощные супы с измельченными разваренными овощами, протертые мясные и картофельные супы.
Мясные блюда: нежирные сорта мяса и птицы без кожи в виде отварных или паровых котлет, суфле, кнелей и т. д.; разрешены рубленые котлеты, бефстроганов, язык; рекомендован соевый белок.
Рыбные блюда: отварная или на пару рыба нежирных сортов куском, рубленая, в виде котлет, суфле.
Гарниры: протертые овощные пюре, суфле, протертые полувязкие каши, пудинги и запеканки из риса, овсяной, гречневой, перловой и манной круп; разрешены отварные макаронные изделия.

Молочные продукты: свежий пресный творог и паровое суфле из него, некислые молочные продукты, нежирное молоко, неострые сыры.
Яйца: паровой белковый омлет.
Закуски: исключены.
Соусы: молочные, ягодные.
Сладкие блюда: желе, муссы из фруктов, печеные яблоки, пастила, зефир, свежие бананы и клубника при переносимости; сахар ограничивают, рекомендовано использовать заменители.
Напитки: слабый чай, компоты, отвар шиповника, разбавленные ягодные сладкие соки.
Жиры:
свежее несоленое сливочное масло в небольшом количестве в блюдах на 3-й день, рафинированные растительные масла – на 5-й день.

Исключаемые продукты и блюда диетического стола № 5П (II)

Из рациона следует исключить жареное, мясные, рыбные, грибные бульоны, насыщенные овощные отвары, любые сырые овощи, свежие фрукты, капусту, репу, редьку, брюкву, лук, чеснок, салаты листовые, щавель, шпинат, редис, грибы, бобовые, жирные сорта мяса, птицы и рыбы, ливер, мозги, соленья, копченья, колбасы, консервы, икру, сало, кулинарные жиры, яйца (кроме белковых омлетов), свежий хлеб, сдобное тесто, мучные изделия, сливки, жирное молоко, майонез, кондитерские изделия, шоколад, какао, мороженое, алкогольные напитки, газированные напитки, острые приправы, пряности и соусы, в том числе томатные.

Примерное меню диетического стола № 5П (II)

Первый завтрак: паровой творожный пудинг, молочная каша, чай.
Второй завтрак: отварной язык, сухари, чай.
Обед: слизистый суп с рисом на овощном отваре, бефстроганов, овощное пюре, компот.
Полдник: рыбное суфле, кисель.
Ужин: кнели из курицы, творог, отвар шиповника.
На ночь: кефир.

Источники:

  1. Приказ Министерства здравоохранения Российской Федерации № 330 «О мерах по совершенствованию лечебного питания в лечебно-профилактических учреждениях РФ» от 05.08.2003

Рецепты диетического стола № 5П (II)

В материале использованы фотографии, принадлежащие shutterstock.com

показания и виды, что можно и нельзя есть


Диета 5п — это модификация стола №5 по Певзнеру.

Что такое диета 5п

Эта система питания направлена на снижение продукции ферментов поджелудочной железы и улучшение метаболизма в органах ЖКТ.

Ее применяют при терапии:

  • острого и хронического панкреатита;
  • холецистита;
  • желчнокаменной болезни.
Стол №5п также полезен при жировом гепатозе печени.

Первые несколько дней пациенту предписывается голодание. В дальнейшем весь период соблюдения диеты делится на 2 части, на протяжении которых в рацион пациента постепенно включают продукты, чтобы не спровоцировать резкого повышения нагрузки и рецидива. Исключаются грубая клетчатка и экстрактивные вещества.


Первая часть накладывает жесткие ограничения, а вторая (более мягкая) предполагает введение в рацион дополнительных блюд.

Диета 5п направлена на снижение нагрузки на органы пищеварения. 

Особенности приготовления блюд стола 5п

Диетический стол № 5п требует употребления пищи, которая не будет раздражать или травмировать органы ЖКТ. Блюда нужно готовить путем варки, обработки паром и тушения. Недопустимо использование острых специй и большого количества соли. Мясо перед отвариванием следует порезать на мелкие куски. Такая обработка поможет устранить из него экстрактивные вещества.

При панкреатите пациентам можно употреблять вегетарианские супы-пюре. Каши должны быть слизистыми. На протяжении первой фазы после термической обработки продукты дополнительно протираются. В этот период фрукты могут применяться только для изготовления желе, киселей и т.д. Во второй фазе диеты нет необходимости перетирать блюда, но они должны иметь мягкую консистенцию. Рекомендованная температура блюд — +23…+35°C.

Разрешенные продукты

В таблице представлены главные продукты, которые можно вводить в рацион:



ВидОсобенности продуктов
Хлеб и выпечкаПодсушенный хлеб Крекеры Печенье галетное Вафли
Птица и мясоИндюшатина Филе перепелки Крольчатина Курятина Постная говядина
РыбаПутассу Лемонема Треска Сайда Щука Макрель Навага Хек Пангасиус Минтай Хариус
Молочная продукцияСгущенное молоко Творог Молоко (нежирное) Сметана
СупыОвощные супы
КрупыГречневая Рисовая Кукурузные хлопья Манная
ЯйцаБелок Желток (ограниченно)
Фрукты и сухофруктыЯблоки Вишня Виноград Абрикос Груша Персик Нектарин Изюм Хурма Слива Бананы
Овощи (термически обработанные)Капуста цветная Брокколи Цукини Морковь Тыква Патиссоны Свекла Редис Огурцы Сладкий перец Помидоры Баклажаны Петрушка Листовой салат
НапиткиМорковный сок Некрепкий чай Кисель Компот
СладостиЖеле Пудинги Мед Творожные запеканки Зефир

Продукты, которые нежелательны

Некоторые продукты провоцируют повышение выработки ферментов поджелудочной железой, поэтому их требуется исключить.

Они перечислены в следующей таблице:

ВидОсобенности продуктов
Хлеб и выпечкаСвежий белый и ржаной хлеб Сдоба
Птица и мясоУтятина Гусятина Жирная и жилистая говядина Куриные сердечки Баранина Печень Копчености Почки Свинина Колбасные изделия
Рыба и морепродуктыИкра Молоки Сом Скумбрия Палтус Сельдь Килька Сайра Осетр Горбуша
Молочная продукцияЖирные творог и сметана Простокваша Майонез Сыр пармезан Острые и соленые сорта сыра
СупыЗеленый борщ Жирные бульоны Рассольник
КрупыНешлифованная рисовая Пшенная Перловая
ЯйцаВареные и жареные яйца
ФруктыВсе свежие фрукты
ОвощиКонсервированные и свежие овощи Нут Редька Брюква Салатный перец
НапиткиГазированная вода Кофе Спиртные напитки
ДесертыМороженое Крем Выпечка Шоколад

Мягкая диета

Мягкая диета, т.е. вторая часть стола №5, назначается пациентам, у которых была подавлена острая симптоматика панкреатита. Кроме того, такой рацион полезен людям, страдающим хронической формой патологии и стремящимся не допустить обострения. Вторая часть диетического стола назначается на 5-7-й день после обострения.

Эта часть системы питания предполагает употребление в сутки:

  • жиров — 80 г;
  • белков — 80 г;
  • углеводов — 300 г.
Калорийность пищи повышается до 2500 ккал. В сутки можно употреблять до 8 г соли. На этой фазе пациенту разрешается ввести в рацион неперетертые овощи и фрукты, подвергшиеся термической обработке. Медленно в рацион вводят мягкие, а затем твердые продукты. По мере расширения меню увеличивают объем порций. Количество приемов пищи сокращают до 5-6 раз.

Диета 5п включает необходимое здоровому организму количество овощей.

Жесткая диета

Жесткая диета, или первая часть стола №5п, назначается в период обострения панкреатита.

Она рассчитана на 5-7 дней и предполагает:

  • включение белков до 60 г;
  • понижение нормы жиров до 50 г;
  • употребление до 200 г углеводов;
  • до 8 приемов пищи в день маленькими порциями;
  • исключение соли;
  • употребление протертых слизистых блюд на воде.




Соблюдать правила диеты следует на любом этапе развития воспалительного процесса.

На протяжении всего периода пациентам требуется низкокалорийный рацион.

Примерное меню на неделю

Важно заблаговременно составить меню на неделю. Оно может выглядеть так:

Понедельник

  1. Завтрак: каша из гречки, суфле из творога.
  2. Ланч: кисель из молока, галетное печенье.
  3. Обед: суп-пюре из овощей, отварная рыба, разваренный рис, компот.
  4. Полдник: салат из отварной свеклы и моркови.
  5. Ужин: тефтели из куриного фарша, овощная икра.
Вторник
  1. Завтрак: паровой белковый омлет, овощное рагу.
  2. Ланч: домашнее желе, манная каша, кипяченый сок моркови.
  3. Обед: суп-пюре, суфле из индейки, макароны.
  4. Полдник: 2 отварных яичных белка, несколько ломтиков нежирного сыра.
  5. Ужин: каша из тыквы, запеченная рыба, чай.

Паровой белковый омлет — достаточно питательное блюдо.

Среда

  1. Завтрак: протертая рисовая каша, паровая котлета из курятины.
  2. Ланч: творог.
  3. Обед: картофельное пюре, котлеты из рыбного фарша.
  4. Полдник: манный пудинг, компот.
  5. Ужин: овощное рагу, говяжий рулет, чай.
Четверг
  1. Завтрак: овсяная каша, джем, галетное печенье, разбавленный сок.
  2. Ланч: кальцинированный творог, компот.
  3. Обед: гречневый суп с протертой курицей, паровые тефтели, запеченные овощи.
  4. Полдник: рисовый пудинг, компот.
  5. Ужин: отварной хек, овощное рагу, кисель.

Овсяная каша — наиболее полезный вариант завтрака.

Пятница

  1. Завтрак: рисовая каша, рыбные котлеты, молочный кисель.
  2. Ланч: галетное печенье, компот из сухофруктов.
  3. Обед: вегетарианский борщ, рисовая каша, котлеты.
  4. Полдник: творожная запеканка с курагой.
  5. Ужин: вермишель, филе индейки, кисель.
Суббота
  1. Завтрак: молочный суп, белковый омлет, чай.
  2. Ланч: компот, галетное печенье.
  3. Обед: овощной суп, гречневая каша, куриные кнели, чай.
  4. Полдник: желе из творога, чай с медом.
  5. Ужин: отварной картофель, куриные котлеты, компот.

Молочный суп — это блюдо, в котором в качестве жидкой основы используется молоко. 

Воскресенье

  1. Завтрак: паровая рыбная котлета, винегрет, чай.
  2. Ланч: запеканка из творога.
  3. Обед: суфле из крольчатины, макароны, компот из сухофруктов.
  4. Полдник: запеченное яблоко.
  5. Ужин: рыбные кнели с овощной подливой, несколько ломтиков хлеба, чай с молоком.



Рецепты блюд

При диете № 5п допускается употребление многих продуктов. Из них можно приготовить немало вкусных и полезных блюд.

Суп-пюре из кабачков и моркови

Суп-пюре из моркови и кабачков не содержит жестких растительных волокон и оказывает обволакивающее действие.

Потребуются:

  • кабачок — 0,5 кг;
  • морковь — 200 г;
  • картофель — 2 шт.;
  • куркума — 0,5 ч. л.;
  • молотый кориандр — 0,5 ч. л.;
  • молоко — 100 мл.

Суп-пюре из кабачков и моркови варится на овощном бульоне. 

Можно добавить в суп небольшое количество соли.

Этапы приготовления супа-пюре:

  1. Промыть и очистить все овощи.
  2. Отварить морковь и картофель.
  3. Добавить в кастрюлю измельченный кабачок.
  4. Смесь варить еще 10-15 минут.
  5. Слить большую часть овощного отвара.
  6. Протереть блендером горячие овощи.
  7. Развести пюре молоком или бульоном до нужной консистенции.

Овощной суп

Овощные супы являются важной частью диеты №5п.

Для приготовления блюда потребуются:

  • картофель — 3 шт.;
  • кабачок — 0,5 кг;
  • морковь — 1 шт.;
  • сладкий перец — 1 шт.;
  • репчатый лук — 1 шт.;
  • петрушка — небольшой пучок;
  • растительное масло — 1 ст. л.

Овощной суп — основа правильного питания.

По вкусу можно вводить в состав супа прованские травы и неострые специи.

Приготовление блюда включает в себя следующие этапы:
  1. Картошку, морковь, лук, кабачок тщательно вымыть, очистить от кожуры и нарезать.
  2. Сладкий перец очистить от сердцевины и разрезать на 4-6 кусков.
  3. Лук и морковь слегка обжарить на растительном масле.
  4. К зажарке добавить сладкий перец и тушить смесь 2-3 минуты.
  5. В воде отварить картофель.
  6. Через 15 минут в кастрюлю добавить измельченный кабачок.
  7. К готовым овощам присоединить зажарку.




Примерно за 5 минут до готовности следует добавить в суп измельченную зелень и специи.

Рисовый суп-пюре

Рисовый суп-пюре можно приготовить из разрешенных столом №5п продуктов.

Потребуются:

  • белый рис — 50 г;
  • луковица — 1 шт.;
  • морковь — 1 шт.;
  • оливковое масло — 2 ст. л.;
  • вода — 2 л.

Рисовый суп-пюре можно готовить на мясном, грибном или овощном бульоне.

Процесс приготовления блюда включает следующие этапы:

  1. Промытый рис залить водой и отварить.
  2. Лук и морковь помыть, очистить и нарезать кубиками.
  3. На оливковом масле обжарить морковь и лук.
  4. За 7 минут до готовности риса добавить к нему зажарку.
Готовый суп необходимо тщательно перетереть блендером.

Молочный суп с мясным пюре

Разнообразить меню поможет молочный суп с мясным пюре. Рецепт его приготовления несложен.

Требуемые ингредиенты:

  • нежирная телятина — 200 г;
  • молоко — 1 стакан;
  • вода — 300 мл;
  • морковь — 1 шт.;
  • луковица — 1 шт.;
  • сливочное масло — 1 ст. л.;
  • мука — 1 ст. л.

Молочный суп с мясным пюре — сытное и питательное блюдо.

Приготовление блюда включает следующие этапы:

  1. Телятину отварить.
  2. Муку обжарить на сливочном масле.
  3. Лук и морковь вымыть, очистить и измельчить.
  4. Овощи слегка обжарить на растительном масле.
  5. Отварную телятину измельчить в блендере.
  6. В сковороде соединить муку, овощи и мясо, а затем обжарить 3-5 минут.
  7. В смесь добавить горячее молоко.
  8. Состав взбить блендером до однородной массы.
Готовое блюдо можно присыпать зеленью.

Пудинг из морковки

Пудинг из моркови — это вкусный и низкокалорийный десерт, который можно быстро приготовить в домашних условиях.

Потребуются:
  • морковь — 200 г;
  • молоко — ¼ стакана;
  • яичный белок — 1 шт.;
  • манная крупа — 2 ч. л.;
  • сахар — 5 г;
  • сливочное масло — 1 ст. л.;
  • сметана — 2 ст. л.;
  • панировочные сухари — 15 г.

Пудинг из морковки — блюдо, относящееся не только к разряду полезных, но и вкусных.

Готовить пудинг лучше всего в духовке, но можно запекать его и в мультиварке.

Этапы процесса:

  1. Морковь помыть и очистить, а затем крупно натереть.
  2. Измельченный овощ тушить на молоке 15 минут на маленьком огне.
  3. Белок взбить до состояния плотной пены.
  4. Смешать морковную массу, сахар, манную крупу и яичную пену.
  5. Массу пудинга выложить на дно емкости.
  6. Форму поставить в духовку на 15 минут при температуре 180 °C.
К столу морковный пудинг следует подавать со сметаной. Сверху его можно присыпать маком или корицей.

Рулет из говядины с омлетом

Рулет из говядины с омлетом лучше готовить в пароварке, но при желании его можно сделать и на водяной бане.

Потребуются такие ингредиенты:

  • говяжий фарш — 200 г;
  • яйца — 4 шт.;
  • молоко — ½ стакана.
Нужно заранее приготовить рукав для запекания или плотную фольгу.

Рулет из говядины — необыкновенно вкусное блюдо.

Процесс приготовления включает такие этапы:

  1. Взбить молоко и 3 яйца.
  2. Фарш, смешанный с яйцом, выложить на фольгу так, чтобы его слой был около 2 см, затем тщательно уплотнить.
  3. На мясо выложить готовый омлет.
  4. С помощью фольги скрутить рулет.
  5. Края тщательно соединить.
  6. Рулет, завернутый в фольгу, в нескольких местах проколоть зубочисткой и поместить в духовку или пароварку для приготовления.

Готовый рулет нужно освободить от упаковки, нарезать кольцами и подать к столу. Дополнить блюдо можно сметанным соусом.

Треска в мультиварке

Филе трески можно приготовить в мультиварке без использования соли.

Потребуются:

  • филе трески — 0,5 кг;
  • петрушка и укроп — 3 ст. л.;
  • молотая гвоздика — ¼ ч. л.;
  • кориандр — ¼ ч. л.;
  • лимонный сок — 3 ст. л.;
  • растительное масло — 3 ст. л.


Треска в мультиварке — идеальный вариант обеда.

Приготовление этого блюда занимает 40 минут и состоит из следующих этапов:

  1. В отдельной емкости смешать лимонный сок, специи, зелень и растительное масло.
  2. Филе трески вымыть и слегка надрезать.
  3. Рыбу выложить на фольгу и обильно смазать смесью лимонного сока, растительного масла, зелени и специй.
  4. Края фольги завернуть, а треску поместить в мультиварку на 25-30 минут.

Подавать к столу запеченное филе можно с овощами, рисом или другим гарниром.

Куриные кнели с творогом

Куриные кнели с творогом хорошо утоляют голод, но при этом не создают нагрузку на органы ЖКТ.

Потребуются:

  • куриный фарш — 0,5 кг;
  • яйцо куриное — 1 шт.;
  • творог — 250 г;
  • свежий укроп — 2-3 веточки;
  • молотый перец — щепотка.

Куриные кнели с творогом — это блюдо, из домашней птицы.

При желании можно ввести в состав блюда немного соли.

Процесс приготовления кнелей включает в себя такие этапы:

  1. Творог протереть через сито.
  2. В отдельной емкости смешать фарш, творог, измельченный укроп и перец.
  3. Мокрыми руками сформировать небольшие котлеты и выложить их на решетку мультиварки или пароварки.
  4. Готовить кнели 25 минут.

Подавать к столу куриные кнели лучше со сметаной. К ним подойдет любой гарнир.

Творожное желе

Творожное желе является хорошей заменой многим десертам.

Для него потребуются:
  • творог — 400 г;
  • молоко — 100 мл;
  • сметана — 400 г;
  • желатин — 25 г;
  • сахар — 2-3 ст. л.

Творожное желе — десерт для любителей сладостей.

При необходимости от использования сахара можно отказаться.

Процесс приготовления блюда следующий:

  1. В молоке растворить желатин и оставить набухать 30 минут.
  2. Емкость с молоком поставить на огонь и прогреть.
  3. Творог протереть через сито, смешать с сахаром и сметаной.
  4. В творожную массу ввести растворенный в молоке желатин.
  5. Смесь тщательно вымешать и разлить по формам.

Желе помещают на 2 часа в холодильник. Чтобы облегчить его извлечение из емкости, форму необходимо опустить на минуту в теплую воду.

Рисовый пудинг

Рисовый пудинг — еще один десерт, который можно быстро сделать дома.

Требуемые ингредиенты:

  • круглый рис — 60 г;
  • молоко — 1 стакан;
  • яйца — 2 шт.;
  • масло сливочное — 25 г;
  • изюм — 20 г;
  • сахар — 1 ст. л.

Рисовый пудинг — блюдо из риса, смешанного с водой или молоком.

Приготовление этого десерта занимает не более 30 минут.

Процесс включает в себя следующие этапы:

  1. Изюм промыть и залить водой для размягчения.
  2. На растопленном в кастрюле сливочном масле слегка обжарить рис.
  3. К рису добавить молоко и варить смесь еще 5-7 минут, чтобы зерна разбухли.
  4. Желтки отделить от белка и смешать с сахаром.
  5. Рис снять с огня и добавить к нему желтки.
  6. С изюма слить воду и добавить в рисовую основу.
  7. Белки взбить до получения плотной пены.
  8. Белковую пену небольшими порциями ввести в рисовую основу.
  9. Формы для запекания тщательно смазать сливочным маслом. В них выложить смесь.
  10. Запекать пудинг в течение 20 минут при температуре 170 °C.
Пудинг не вынимают из форм до остывания, подают к столу в холодном виде.

Манный пудинг с яблоками

Для приготовления в домашних условиях манного пудинга потребуются следующие ингредиенты:
  • манная крупа — 5 ст. л.;
  • молоко — 1 стакан;
  • яблоко — 2 шт.;
  • куриное яйцо — 2 шт.;
  • масло сливочное- 2 ст. л.;
  • сахар — 2 ст. л.

Манный пудинг с яблоками является своеобразным усовершенствованием манной каши.

Чтобы сделать манный пудинг, нужно:

  1. Налить молоко в кастрюлю и довести до кипения, а затем добавить к нему манную крупу и сахар.
  2. В готовую кашу влить 1 ст. л. масла.
  3. Белок взбить и смешать с охлажденной массой с манной крупой.
  4. Яблоки помыть, очистить, нашинковать и смешать с сахаром, а затем слегка обжарить.
  5. Форму смазать сливочным маслом. На дно налить приготовленную смесь, выложить яблоки, которые затем прикрыть слоем каши.
  6. Запекать пудинг 15 минут в духовке при температуре 170 °C.
Пудинг следует достать из формочек только после остывания. Блюдо можно подавать к столу вместе с фруктовым желе.

Отзывы и результаты

Эта система питания давно назначается пациентам при патологиях поджелудочной железы, поэтому есть немало отзывов о ней.

Светлана, 39 лет, Краснодар: «В прошлом году впервые столкнулась с приступом панкреатита. После 2 дней голодания врач назначил соблюдение диеты №5п. Были сложности с переходом на такой рацион. Пришлось учиться готовить полезные блюда, но после начала соблюдения диеты состояние улучшилось. Больше приступов не было».

Игорь, 47 лет, Иркутск: «В молодости злоупотреблял алкоголем, что привело к развитию хронического панкреатита. Попал в больницу, где врач назначил препараты и стол №5п. Начал соблюдать рекомендации специалиста и перешел на рекомендованное меню. Состояние быстро стабилизировалось».

Рекомендации врачей-диетологов

Жесткий вариант стола №5п следует использовать только по назначению врача. Хотя рекомендованные в этот период блюда и способствуют восстановлению работы поджелудочной железы, они содержат недостаточное количество витаминов и минералов. Мягкого варианта диеты можно придерживаться пожизненно, т.к. он более сбалансирован.

При соблюдении стола №5п нужно сократить до минимума употребление соли и сахара. Желательно отказаться от добавления этих веществ в блюда. Пищу необходимо употреблять небольшими порциями.

Посмотрите также варианты заказа индивидуального питания (если позволяет бюджет):


Примерное меню диеты № 5п (панкреатической) – протертый вариант

Примерное меню диеты № 5п (панкреатической) – протертый вариант

1-й завтрак: мясные паровые котлеты, каша овсяная (гречневая) на воде, протертая, чай с молоком.

2-й завтрак: творог, кисель.

Обед: овощной суп (без капусты) протертый, мясное суфле с картофельным пюре, компот из свежих протертых яблок.

Полдник: отвар шиповника, сухари.

Ужин: белковый паровой омлет, манная каша, некрепкий чай.

На ночь: минеральная вода боржоми (1/2 стакана).

Примерное меню диеты № 5п – непротертый вариант

1-й завтрак: винегрет, отварное мясо, гречневая рассыпчатая каша.

2-й завтрак: сухие фрукты (чернослив, курага), некрепкий чай с несдобным печеньем.

Обед: салат, овощной суп, отварная курица с отварным картофелем, яблоко.

Полдник: творог, компот из сухих фруктов.

Ужин: отварная рыба с отварной вермишелью, некрепкий чай.

На ночь: чай с молоком, сухарик.

При обострении хронического панкреатита лечебное питание направлено на максимальное механическое и химическое щажение поджелудочной железы и всей системы пищеварения.

Пользуйтесь, но не злоупотребляйте – таково правило мудрости. Ни воздержание, ни излишества не дают счастья.

Ф. ВОЛЬТЕР (1694–1778), французский писатель, философ

В первые (1-й – 2-й) дни обострения заболевания показан полный покой (постельный режим). Разрешается употреблять минеральную воду типа «боржоми», «славяновская» (1 – 1,5 л в день). Вода должна быть комнатной температуры или слегка подогретой, без углекислого газа. Возможно также употребление отвара шиповника (не очень насыщенного), некрепкого и несладкого чая (с минимальным количеством сахара).

По мере улучшения самочувствия (обычно это бывает на 3-й день с начала обострения) назначают щадящую диету:

• слизистые супы,

• протертые жидкие каши, овощные пюре, молочные и фруктовые кисели.

Все блюда должны быть жидкими или полужидкими, вареными или приготовленными на пару, протертыми.

Данный текст является ознакомительным фрагментом.

Продолжение на ЛитРес

диетический стол №5п и онлайн помощник конструктор персональной диеты

• диеты при повышенном уровне холестерина
• похудеть во время кормления грудью
• здоровье диеты еда
• диета виктории бекхэм после родов
• новые статусы про диету
• эффективные диеты похудния раз и навсегда
• как выбрать себе правильную диету

• диет анджелины джоли
• aллен рр лёгкий способ похудеть
• диете похудела
диетический стол №5п и онлайн помощник конструктор персональной диеты
• диеты срочно за 2 месяца результат?
• диеты для похудания рецепты
• как вызвать месячные после диеты
• диета при протезировании клапанов сердца
• похудение при помощи диет
• диета пари мочекаменной болезни
• диетическая еда доставка
• как похудеть в животена тренажерах
• диеты для похудения на 20кг
• диета питание по 1 группе крови какие можно фрукты
• похудеть на 6 кг за 3 дня
• диета три яблока
• рецепты блюда для похудания диета
По сути, диетический стол №5п и онлайн помощник конструктор персональной диеты трудно назвать диетой.
Это способствует потере жировой ткани при сохранении и даже наращивании мышечной. Диета Кима Протасова предписывает потреблять большое

Плюсы диетический стол №5п и онлайн помощник конструктор персональной диеты
Похудение по диетический стол №5п и онлайн помощник конструктор персональной диеты
Раз в 3 месяца где-то повторяю эту диету с соком.. Тут почитала форум ( конечно, не истина в последней инстанции): DE BIO-HCG+ OVERGEWICHTTHERAPIE Там.. я похудела только на килограмм от грейпфрутов с яйцами.

Программа похудения по диетический стол №5п и онлайн помощник конструктор персональной диеты рассчитана на три этапа.
Похудеть на четыре килограмма за одну неделю вам поможет диета по гликемическому индексу.Это одна из немногих диет которая не навредит

Основное правило диетический стол №5п и онлайн помощник конструктор персональной диеты
8 июл 2010 Самая безобидная и эффективная для нашего организма диета – это После завтрака, через часа 2,3 нужно съесть рыбное блюдо с

Первый этап диетический стол №5п и онлайн помощник конструктор персональной диеты:7 янв 2012 Безуглеводная диета для бодибилдеров, диета для улучшения кожи лица.
Необычайной популярностью пользуются суповые диеты. Потребуется шесть крупных луковиц, 300 г корня сельдерея, 300 г моркови. Все это можно

Второй этап диетический стол №5п и онлайн помощник конструктор персональной диеты:13 мар 2012 Диета для похудения для мужчин, форум таблетки для похудения.

Третий этап диетический стол №5п и онлайн помощник конструктор персональной диеты:Семь дней придется усиленно кушать огурцы – они являются основой диеты. Причем огурцы необходимо есть только в свежем виде, без соленых

диетический стол №5п и онлайн помощник конструктор персональной диеты, отзывы:8 июн 2010 Диета на гречке (гречневая диета) рассчитана на одну – две недели, повторять ее можно не ранее, чем через месяц после окончания

диетический стол №5п и онлайн помощник конструктор персональной диеты

Диета по Певзнеру — стол №5п

Диетический стол № 5п предназначен для больных хроническим панкреатитом. Он характеризуется пониженной до 1800 ккал калорийностью рациона, уменьшенным до 200 г количеством углеводов, и примерно 100-120 г белков и 80 г жиров в сутки на человека. Рацион строится на ограничении экстрактивных веществ растительного и животного происхождения, которые стимулируют работу поджелудочной железы, и желудка, запрещаются по той же причине блюда с приправами, пища, богатая клетчаткой, жирные жареные блюда, и продукты, которые отличаются повышенной жирностью сами по себе. Разрешенные продукты стола 5п Стол 5п назначается на период выздоровления, при остром панкреатите от пищи некоторое время воздерживаются, а потом применяют стол 5 либо 4г, последний, если состояние осложнено заболеваниями кишечника. Мясо и рыба допускаются исключительно в нежирном виде, можно употреблять как в форме фарша, так и филе куском, следует удалять видимый жир с говядины, и полностью исключать свинину. Супы обычно назначают преимущественно вегетарианские, с добавлением кабачков и цветной капусты, можно и тыквенный суп. Крупы – гречка, рис, обычный белый, вермишель (тонкие макароны), манка и овсянка. Готовить каши предлагается преимущественно на воде, можно использовать и воду пополам с молоком. В готовом виде из каш делают протертые блюда, крупяные суфле и т.п. Яйца предлагается разделять, и употреблять исключительно белки. Допускается половина желтка в сутки. Творог – до 9% жирности, аналогично и другие молочные продукты. Сыры кроме нежирных и не острых сортов должны быть исключены из рациона. Молоко допускается к употреблению только при хорошей переносимости, и как самостоятельный напиток, не в составе молочных супов. Кисломолочные напитки не должны быть «старыми», то есть желательно употреблять продукты в свежем виде, не позднее 3 суток с момента производства. Сметана и сливочное масло используются ограниченно, как добавки к супам и кашам, примерно по 5-10 г на порцию блюда. Из овощей рекомендуется тыква, цветная капуста, зеленый горошек, кабачки, картошка. Запрещенные продукты стола 5п:
Ограничивается простой белый сахар, вместо него допускается употребление 20-30 г ксилита, в виде добавки в блюда. Запрещаются горячие блюда, в том числе и напитки, а также холодные блюда и употребление продуктов из холодильника сразу, без разогревания. Остальной «запретный список» напоминает пятый стол. Исключаются так называемые тугоплавкие жиры, говяжий и бараний жир, а также находящееся почти во всей современной выпечке пальмовое масло. Кроме выпечки, данный продукт встречается в йогуртах, соусах, кулинарных жирах для жарки, поэтому состав подобной еды, приобретаемой в супермаркетах, следует изучать очень подробно. Пшено, перловка, рассыпчатые каши из риса, в том числе, коричневого, а также бобовые, грибы, бульоны и супы из них раздражают ЖКТ и требуют повышенной секреторной активности, поэтому не подходят для больных панкреатитом. Запрещается шоколад, жирная и сладкая выпечка, торты, десерты. Также в этом списке любая жирная рыба, в том числе и соленая сельдь, икра, копчености, рыбная нарезка. Естественно, запрещается колбаса, мясные деликатесы, сало, консервы из мясопродуктов, печень. Изделия из слоеного и сдобного теста, а также свежий хлеб полностью исключаются из рациона больных панкреатитом. Среди супов под запретом холодные варианты для лета – свекольник и окрошка -, а также все виды молочных супов, и блюда из жирного мяса, например, харчо и борщ. Нельзя есть и все овощи, кроме разрешенных, особенно репу и крестоцветные, типа белокочанной капусты. Важно: прежде чем сесть на диету по Певзнеру — стол №5п проконсультируйтесь с врачом.
 Источник: диета ру.

Диета номер 5 п меню на неделю

Большинство врачей высоко оценивает разделение рациона по методике советского диетолога Певзнера. Пятый стол наиболее известен из всех его программ питания, так как он может быть назначен людям при гастрите, нарушениях функции печени, панкреатите и холецистите. Диета 5 стол в первую очередь налаживает отток желчи, а при гастрите она применяется из-за сокращенного содержания жира. Особенностью этой системы питания становится то, что при ней концентрация углеводов и белков в рационе оптимальна.

Поиск данных по Вашему запросу:

Медицинские справочники:

Истории болезней:

Консультации экспертов:

Дождитесь окончания поиска во всех базах.
По завершению появится ссылка для доступа к найденным материалам.

ПОСМОТРИТЕ ВИДЕО ПО ТЕМЕ: Диета №5 по Певзнеру

Диетический стол номер 5: рецепты и меню на неделю

В этой статье я напишу подробное меню популярной диеты 4б, которая назначается при различных заболеваниях желудочно-кишечного тракта, а также список разрешенных и запрещенных продуктов, особенности диеты и меню. Данная диета часто назначается людям, имеющим проблемы с желудочно-кишечным трактом, например, хронические колиты или же их обострения, при гастроэктомии желудка, а также другие заболевания, сопровождающиеся болями в желудке и диареей. Диета номер 4б призвана за несколько дней уменьшить боли в желудке, а также обеспечить кишечнику легкую работу.

За короткое время диета улучшает пищеварение за счет употребления определенной еды, приготовленной особым способом, улучшает ваше общее самочувствие, уменьшает воспаление кишечника, а также восстанавливает его функцию.

Кстати, гипохолестеринемическая диета также хорошо оздоровляет организм. Использовать диету можно и без назначения врача, если вы наблюдаете проблемы с ЖКТ, а также желаете оздоровить организм и скинуть несколько лишних килограммов.

Диета при гастроэктомии желудка 4б в первую очередь предусматривает дробное питание. За день вы должны кушать раз. Время приемов пищи может выглядеть так:. Диета по Певзнеру подразумевает употребление слизистых супов и других жидких блюд, вареных и протертых рагу, жидких каш.

Пищу можно только варить или делать на пару. На период диеты, который назначит гастроэнтеролог, важно не допускать употребления слишком горячей и слишком холодной еды. Даже в жару не стоит делать несколько глотков холодной воды.

По возможности еда должна быть приближена к комнатной температуре. Мучные изделия. Хорошо подойдут сухарики, темный хлеб, сдобное печенье, бисквит. Изредка можно добавлять в рацион домашнюю выпечку: манник или бисквит.

Птица и мясо. Можно употреблять только нежирные сорта, например, курицу, телятину, говядину, индейку, кролик. Как уже говорилось выше, пища должна быть приготовлена либо на пару, либо отварная. Птицу необходимо употреблять без кожи! Разрешаются супы на некрепком бульоне, а также с протертыми мясными продуктами, вермишелью и овощами. Как уже говорилось выше, разрешаются только протертые жидкие каши из следующих круп: овсяная, гречневая , манная, рисовые.

Разрешается не более двух штук в день. Молочные продукты. Хорошо подойдут на такой диете нежирный творог, ацидофилин и кефир. Сладкие блюда или десерты. Разрешаются сладкие фрукты без кожицы и ягоды до граммов в день, если хорошая переносимость. Из сладкого можно пастилу, зефир, джемы и варенье. На десерт хорошо кушать желе и кисели домашнего приготовления из некислых ягод. Из домашней выпечки можно бисквит и манник.

Хорошо подойдут морковь и картофель — отварные и обязательно протертые. Можно также немного отварных кабачков и тыкву. При хорошей переносимости можно томаты также до граммов в день. Можно томатный сок, приготовленный в домашних условиях. Хорошо добавлять в блюда свежую зелень, а именно: укроп, петрушку, лавровый лист.

Добавлять в выпечку и некоторые блюда можно корицу и ванилин. Разрешается пить компоты некислых ягод, свежие кисели домашнего приготовления , чай, кофе, а также какао желательно на воде , можно следующие соки: клубничный, апельсиновый, вишневый и мандариновый, но с добавлением воды в пропорции Стол диета 4б на неделю или же на несколько недель поможет вам избавиться от болей, а также сделать ЖКТ крепким и здоровым. Воспользуйтесь данной диетой, чтобы чувствовать себя лучше!

Ваш адрес email не будет опубликован. Следить за комментариями к статье. Перейти к содержимому В этой статье я напишу подробное меню популярной диеты 4б, которая назначается при различных заболеваниях желудочно-кишечного тракта, а также список разрешенных и запрещенных продуктов, особенности диеты и меню. Предыдущая запись Гречневая диета Пелагеи с рецептом на неделю.

Следующая запись Гипохолестеринемическая диета с меню и описанием. One Comment Добавьте свой Kelonelty :. Добавить комментарий Отменить ответ Ваш адрес email не будет опубликован.


Недельное меню диеты 5п при панкреатите

Показания: назначается при остром панкреатите и обострении хронического, начиная со дня от начала атаки болезни — когда завершается период голодания или осуществляется переход с парентерального питания на энтеральное. Главная цель — обеспечить максимальный покой воспаленному органу. Это достигается следующим образом:. Питание дробное, прием пищи через каждые 2 часа раз в сутки , маленькими порциями — по г. Разрешаются только отварные или приготовленные на пару блюда, с последующим измельчением пюрирование, перетирание, взбивание на блендере до жидкого или полужидкого состояния. Все блюда подаются только в теплом виде.

13 03 — Диета номер 5 — это один из методов комплексной терапии, необходимый. Диета номер 5п при панкреатите используется в случае. 12 05 — Меню диеты на неделю.

Чем можно разнообразить свое меню, соблюдая диету номер 5?

Часто причиной патологических состояний становится неправильное питание. Параллельно с медикаментозной терапией большое значение имеет лечебное питание. Родителям важно осознать, что лечебное питание — стол номер пять — является способом облегчить состояние ребенка и ускорить его выздоровление. Поэтому они должны проявить стойкость и на период времени, в течение которого рекомендована диета, стараться не давать ребенку запрещенные продукты. Необходимо ознакомиться с рекомендациями к диете номер 5 для детей, согласно которым под запрет попадают:. Кормить маленького пациента каждый день нужно достаточно и разнообразно. Готовят такой омлет на сливочном масле. Его небольшое количество растапливают на антипригарной сковороде.

Диета 5п Меню На Неделю При Панкреатите

Видеорецепты Видео рецепты вкусных блюд. На завтрак — лепешка с цукини. Обед — суп с зеленым горошком и плавлен Диета стол 5. Что можно?

Диета 5п при панкреатите подразделяется на два вида: первый вариант предписывается больным, находящимся в стадии обострения, а второй предназначен для тех, кто находится в стадии ремиссии или выздоровления. Стол номер 5п является неотъемлемой частью комплексной терапии, и, как всякое лечение, должен быть назначен только лечащим врачом.

Диетический стол №5п

Диету 9 также можно применять для похудения. Все продукты питания, представленные ниже, необходимо употреблять в количестве, соответствующей суточной норме по содержанию углеводов и жиров. Овощи, зелень: баклажаны, кабачки, капуста, огурцы, салат, томаты, тыква. Акцент по углеводам: зеленый горошек, картофель, морковь, свекла. Мясо: курица, индейка, телятина, говядина, баранина, диетическая колбаса, диабетическая колбаса.

Диета 5 стол по Певзнеру

Известный советский ученый М. Певзнер разработал специальную диету под названием стол 5, соблюдение которой существенно помогает в лечении болезней печени, желчевыводящих путей, желчного пузыря и некоторых других патологических состояний организма. Диета стол 5а прописывается пациентам с хроническими панкреатитами и при обострении гепатита. Для снижения нагрузки на поджелудочную железу все продукты, в том числе овощи и фрукты, употребляются только после кулинарно-термической обработки. Энергоценность дневного меню варьируется в пределах от до ккал.

Когда назначается диета Стол 5 для детей? Как составить меню на неделю для ребенка из доступных продуктов? Как диета №5 помогает вылечиться от лямблий и запоров? Рецепты вкусных и полезных 5/5(2).

Особенности диеты № 5 при панкреатите

Панкреатит — заболевание поджелудочной железы воспалительного характера. Причины поражения ее многообразны: обструкция закупорка панкреатического протока, токсическое отравление, воздействие лекарственных препаратов, сосудистые нарушения, инфекционные и паразитарные заболевания, травмы. Различают острый и хронический панкреатит.

Диета № 5П, стола № 5П

ВИДЕО ПО ТЕМЕ: 9 продуктов, в которые влюблена Поджелудочная Железа! Вот чем можно побаловать этот капризный орган

В этой статье я напишу подробное меню популярной диеты 4б, которая назначается при различных заболеваниях желудочно-кишечного тракта, а также список разрешенных и запрещенных продуктов, особенности диеты и меню. Данная диета часто назначается людям, имеющим проблемы с желудочно-кишечным трактом, например, хронические колиты или же их обострения, при гастроэктомии желудка, а также другие заболевания, сопровождающиеся болями в желудке и диареей. Диета номер 4б призвана за несколько дней уменьшить боли в желудке, а также обеспечить кишечнику легкую работу. За короткое время диета улучшает пищеварение за счет употребления определенной еды, приготовленной особым способом, улучшает ваше общее самочувствие, уменьшает воспаление кишечника, а также восстанавливает его функцию. Кстати, гипохолестеринемическая диета также хорошо оздоровляет организм. Использовать диету можно и без назначения врача, если вы наблюдаете проблемы с ЖКТ, а также желаете оздоровить организм и скинуть несколько лишних килограммов.

Панкреатит — одно из наиболее популярных заболеваний внутренних органов.

При лечении многих заболеваний, ключевую роль играет лечебное питание. Правильный подбор блюд и продуктов, технологий их приготовления и кратности питания, помогает организму не допустить обострения болезни и справиться с ней самостоятельно. Лечебная диета — это специально разработанный рацион, который рекомендован в медицинской практике и помогает пациенту получить полный комплекс полезных веществ, при этом не допускает рецидива заболевания. При этом используют номерную систему диет, которые назначают при разных видах заболеваний:. Диетические блюда могут быть не только полезными, но и вкусными, главное использовать свежие ингредиенты.

Когда у человека обнаруживается хроническое заболевание поджелудочной железы, ему назначается диета 5п; меню на неделю при панкреатите разрабатывается и во время острой формы. Этот способ питания направлен не на то, чтобы больной смог похудеть, а чтобы убрать из его рациона твердую пищу, которая негативно воздействует на поджелудочную. Лечебное меню еще и восстанавливает деятельность этого важного органа. Так какой должна быть диета 5п?

Диета 5П — диета

0,7к —

при хроническом панкреатите в стадии выздоровления (вне обострения или после него) назначается диета 5П. Как этот план еды?

Цель диеты

Лечебное питание способствует восстановлению функций поджелудочной железы. Диета защищает от механического и химического раздражения стенок желудочно-кишечного тракта, предотвращает жировую инфильтрацию, способствует нормализации деятельности желчного пузыря.

Характеристики диеты

Данная диета характеризуется повышенным выделением белка при снижении доли эфирных масел, жиров (преимущественно тугоплавких), углеводов, пуринов, экстрактивных веществ, холестерина и сырой клетчатки.

Изделия запеченные (корочки не должно быть), приготовленные на пару или отварные. Еду подают предварительно нарезанной или обтертой. Все жареное, холодное и горячее исключает. Больные должны есть 5-6 раз в день.

распределение по химическому составу следующее:
• расход жидкости – 1.5 литров в сутки (без учета первых блюд)
• норма соли — 10 г в сутки
• норма углеводов — 300-350 г (30-40 г сахара)
• норма жиров — 70-80 г (из них 75 -80% — животного происхождения)
• Норма белка 100-120 г (из них 60-65 % — животного происхождения)
• Оптимальная калорийность — 2500-2600 ккал

Диетическое питание

Мука
• Рекомендовано: крекеры, вчерашний или подсушенный пшеничный хлеб, несладкие бисквиты.
• Запрещены: торты из сдобного и слоеного теста, свежий хлеб и хлеб из ржаной муки.

Супы
• Рекомендуются: вегетарианские супы с морковью, картофелем, тыквой, кабачками, овсянкой, манной и гречневой кашей, вермишелью, рисом (в каждую порцию можно добавить 10 г нежирной сметаны или 5 г масла).
• запрещены: супы, молочно-рыбные, грибные, мясные бульоны, а также супы с пшеном, борщи, холодные супы, ухи.

Мясо
• Рекомендуется: говядина, кролик, телятина, курица и индейка.
• Запрещено: утка и гусь, жирное мясо.Исключаются колбаса, копчености, консервы, мозги, печень, почки.

Рыба
• Рекомендовано: рыба с низким содержанием жира (подается куском, отварная или в виде котлет). Можно приготовить холодец из рыбы, предварительно его отварив.
• табу: рыба жареная, копченая, тушеная, соленая, рыба жирная, а также рыбные консервы и икра.

Молоко
• Рекомендуются: свежий кислый творог, обезжиренный кальцинированный творог в натуральном виде, запеченный и паровой чизкейк с зеленым чаем. Молоко вводят в рацион для нормальной переносимости.Допустимый и нежирный мягкий сыр, молочные напитки, сметана и сливки (небольшое количество).
• Запрещены: молочные продукты повышенной жирности, подслащенные молочные продукты.

Яйца
• Рекомендовано: не более чем в 2 раза больше белка и половины желтка в день (белковые омлеты, приготовленные или добавленные в блюда).
• Запрещены: блюда с добавлением целых яиц, яиц, сваренных вкрутую или жареных на жире.

Крупы
• Рекомендуются: половецкие протертые каши из овсяной, гречневой, манной и рисовой муки (варятся на воде или разбавленном молоке).Допустимо готовить крупяные пудинги, суфле, запеканки.
• Запрещено: хрустящие хлопья (не рекомендуется есть перловку, перловку, кукурузу и просо).

Овощи
• Рекомендуются: запеченные, вареные, протертые овощи (морковь, картофель, свекла, цветная капуста, тыква, кабачки, зеленый горошек).
• Запрещены: репа, баклажаны, капуста, редис, редька, чеснок, лук, шпинат, щавель, перец сладкий, грибы.

Соусы
• Рекомендуются: полусладкие молочные, фруктово-ягодные подливы, соусы на слабом овощном бульоне.
• Запрещены: соусы к рыбным, грибным, мясным бульонам, соусы с томатами и специями.

Напитки
• Рекомендуются: сладкий некрепкий чай с долькой лимона или нежирным молоком, отвар шиповника, ягодные и несладкие фруктовые соки, разбавленные водой.
• запрещены: какао, кофе, виноградный сок, холодные и газированные напитки.

Жиры
• Рекомендуются: сливочное масло (около 30 г в день) и рафинированное растительное масло (около 15 г в день).
• запрещены: любые другие жиры.

отзывов

Диета 5П – план лечебного питания.Судя по отзывам, отсутствие грубой, жирной и мучной пищи обеспечивает стойкое улучшение состояния больного.

IJMS | Бесплатный полнотекстовый | МикроРНК-126b-5p усугубляет развитие жировой ткани и ожирение, вызванное диетой

Вклад авторов

Conceptualization, L.S., J.H., and L.Z.; методология, Л.С. и Дж. Х.; программное обеспечение, JH; валидация, Ю.Дж., Г.Т. и XL; формальный анализ, X.H. и Л.Б.; расследование, Ю. З., Л. К. и Л. Н.; ресурсы, Ю.З., Л.К. и Л.Н.; курирование данных, Л.С. и Дж. Х.; написание — подготовка первоначального проекта, Л.С. и Дж. Х.; написание-обзор и редактирование, С.З. и Л.З.; надзор, С.З. и Л.З. Все авторы прочитали и согласились с опубликованной версией рукописи.

Рисунок 1. миР-126b-5p положительно коррелировала с адипогенезом. Экспрессия miR-126b-5p в различных тканях 8-недельных мышей ( A ), паховой жировой ткани мышей с ожирением, индуцированным диетой (HFD), и нормальных мышей (NCW) ( B ), паховой жировой ткани ткань 1–6-недельных мышей ( C ) и стадия дифференцировки преадипоцитов 3T3-L1 ( D ).Данные представлены как среднее ± SEM (n = 3).

Рисунок 1. миР-126b-5p положительно коррелировала с адипогенезом. Экспрессия miR-126b-5p в различных тканях 8-недельных мышей ( A ), паховой жировой ткани мышей с ожирением, индуцированным диетой (HFD), и нормальных мышей (NCW) ( B ), паховой жировой ткани ткань 1–6-недельных мышей ( C ) и стадия дифференцировки преадипоцитов 3T3-L1 ( D ). Данные представлены как среднее ± SEM (n = 3).

Рисунок 2. миР-126b-5p способствовала пролиферации преадипоцитов 3T3-L1. ( A ) Экспрессия miR-126b-5p после трансфекции миметиков miR-126b-5p, миметиков NC, ингибиторов NC и ингибиторов miR-126b-5p через 48 часов. Анализ EdU ( B ), количественный анализ EdU положительных клеток ( C ) и анализ CCK8 ( D ) использовали для оценки пролиферации преадипоцитов 3T3-L1. ( E ) Экспрессия Cycling D1, Cycling E1, CDK2, CDK4, p21 и p53 через 48 ч после трансфекции миметиков miR-126b-5p, миметиков NC, ингибиторов NC и ингибиторов miR-126b-5p (шкала , 200 мкм).Данные представлены как среднее значение ± SEM (n = 3) (NS — недостоверно, p > 0,05, * p < 0,05, ** p < 0,01, *** p < 0,001).

Рисунок 2. миР-126b-5p способствовала пролиферации преадипоцитов 3T3-L1. ( A ) Экспрессия miR-126b-5p после трансфекции миметиков miR-126b-5p, миметиков NC, ингибиторов NC и ингибиторов miR-126b-5p через 48 часов. Анализ EdU ( B ), количественный анализ EdU положительных клеток ( C ) и анализ CCK8 ( D ) использовали для оценки пролиферации преадипоцитов 3T3-L1.( E ) Экспрессия Cycling D1, Cycling E1, CDK2, CDK4, p21 и p53 через 48 ч после трансфекции миметиков miR-126b-5p, миметиков NC, ингибиторов NC и ингибиторов miR-126b-5p (шкала , 200 мкм). Данные представлены как среднее значение ± SEM (n = 3) (NS — недостоверно, p > 0,05, * p < 0,05, ** p < 0,01, *** p < 0,001).

Рисунок 3. миР-126b-5p усиливала отложение липидов в преадипоцитах 3T3-L1. ( A ) Экспрессия миР-126b-5p после трансфекции миметиков миР-126b-5p, миметиков NC, ингибиторов NC и ингибиторов миР-126b-5p через восемь дней после дифференцировки 3T3-L1.( B E ) Окрашивание Oil Red O ( B ), количественная оценка положительной области окрашивания Oil Red O ( C ), содержание TAG ( D ) и TC ( E ) использовали для оценки дифференцировки преадипоцитов 3T3-L1. ( F ) Экспрессия FABP4, C/EBPα, FAS, adipor2, LPL и PPARγ после трансфекции миметиков miR-126b-5p, миметиков NC, ингибиторов NC и ингибиторов miR-126b-5p через восемь дней после 3T3-L1 дифференциация (масштабные линейки, 200 мкм).Данные представлены как среднее ± SEM (n = 3) (* p < 0,05, ** p < 0,01, *** p < 0,001).

Рисунок 3. миР-126b-5p усиливала отложение липидов в преадипоцитах 3T3-L1. ( A ) Экспрессия миР-126b-5p после трансфекции миметиков миР-126b-5p, миметиков NC, ингибиторов NC и ингибиторов миР-126b-5p через восемь дней после дифференцировки 3T3-L1. ( B E ) Окрашивание Oil Red O ( B ), количественная оценка положительной области окрашивания Oil Red O ( C ), содержание TAG ( D ) и TC ( E ) использовали для оценки дифференцировки преадипоцитов 3T3-L1.( F ) Экспрессия FABP4, C/EBPα, FAS, adipor2, LPL и PPARγ после трансфекции миметиков miR-126b-5p, миметиков NC, ингибиторов NC и ингибиторов miR-126b-5p через восемь дней после 3T3-L1 дифференциация (масштабные линейки, 200 мкм). Данные представлены как среднее ± SEM (n = 3) (* p < 0,05, ** p < 0,01, *** p < 0,001).

Рисунок 4. Adipor2 и ACADL являются прямыми генами-мишенями miR-126b-5p, измеренными в клетках HEK-293T. ( A , B ). Репрессивный эффект miR-126b-5p на активность Adipor2 и ACADL 3’UTR измеряли с помощью анализа люциферазы.Данные представлены как среднее ± SEM (n = 3) (* p < 0,05, ** p < 0,01, *** p < 0,001).

Рисунок 4. Adipor2 и ACADL являются прямыми генами-мишенями miR-126b-5p, измеренными в клетках HEK-293T. ( A , B ). Репрессивный эффект miR-126b-5p на активность Adipor2 и ACADL 3’UTR измеряли с помощью анализа люциферазы. Данные представлены как среднее ± SEM (n = 3) (* p < 0,05, ** p < 0,01, *** p < 0,001).

Рис. 5. миР-126b-5p усугубляла ожирение мышей, вызванное диетой с высоким содержанием жиров. ( A ) Экспрессия miR-126b-5p в паховой жировой ткани постоянно повышалась в течение восьми недель. Масса тела ( B ), увеличение массы тела ( C ), масса пахового жира ( D ), масса окологонадного жира ( E ) и масса печени ( F ) в четырех группах. ( G ) Окрашивание H&E паховой жировой ткани в четырех группах. ( H ) Количественное определение размера клеток и количества перигонадного жира в группах H-126 и H-NC.Окрашивание печени масляным красным O ( I ) и статистика частоты положительных результатов окрашивания масляным красным O ( J ) в печени. Концентрация ТАГ ( K ) и ТС ( L ) в сыворотке крови. Концентрация ТАГ ( М ) и ТС ( N ) в паховой жировой ткани, перигонадной жировой ткани и печени. Тест на толерантность к глюкозе, GTT ( O ) и тест на толерантность к инсулину, ITT ( P ). ( Q ) Экспрессия FABP4, SCD-1, FAS, ELOVL6, LPL, PPARα, ACADL и ACOX2 в паховой жировой ткани.Все результаты были представлены как среднее значение ± стандартная ошибка среднего (n = 4–6, масштабные линейки, 100 мкм) (NS — незначимо, p > 0,05, * p < 0,05, ** p < 0,01, *** p < 0,001) .

Рисунок 5. миР-126b-5p усугубляла ожирение мышей, вызванное диетой с высоким содержанием жиров. ( A ) Экспрессия miR-126b-5p в паховой жировой ткани постоянно повышалась в течение восьми недель. Масса тела ( B ), увеличение массы тела ( C ), масса пахового жира ( D ), масса окологонадного жира ( E ) и масса печени ( F ) в четырех группах.( G ) Окрашивание H&E паховой жировой ткани в четырех группах. ( H ) Количественное определение размера клеток и количества перигонадного жира в группах H-126 и H-NC. Окрашивание печени масляным красным O ( I ) и статистика частоты положительных результатов окрашивания масляным красным O ( J ) в печени. Концентрация ТАГ ( K ) и ТС ( L ) в сыворотке крови. Концентрация ТАГ ( М ) и ТС ( N ) в паховой жировой ткани, перигонадной жировой ткани и печени.Тест на толерантность к глюкозе, GTT ( O ) и тест на толерантность к инсулину, ITT ( P ). ( Q ) Экспрессия FABP4, SCD-1, FAS, ELOVL6, LPL, PPARα, ACADL и ACOX2 в паховой жировой ткани. Все результаты были представлены как среднее значение ± стандартная ошибка среднего (n = 4–6, масштабные линейки, 100 мкм) (NS — незначимо, p > 0,05, * p < 0,05, ** p < 0,01, *** p < 0,001) .

Таблица 1. миР-126b-5p влияла на состав жирных кислот в преадипоцитах 3T3-L1.

Таблица 1. миР-126b-5p влияла на состав жирных кислот в преадипоцитах 3T3-L1.

***
Жирная кислота Концентрация (мкг / мл) вверх / вниз
MIMics NC MIM-126B-5P MIMICS
C6: 0 0 0 —-
C8:0 0 0 —-
C10:0 0 0.01 ± 0.0004 UP
C11: 0 0 0 —-
C12: 0 C12: 0 0 0,02 ± 0,002 UP
C13: 0 0,01 ± 0.00 0,02 ± 0.001 UP *** UP ***
C14: 0 0.54 ± 0,05 1.23 ± 0,04 UP ***
C14: 1 0 0 —-
C15:0 0.46 ± 0,05 1,01 ± 0,02 UP ***
C15: 1 C15: 1 0 0 —-
C16: 0 8,29 ± 0 18.16 ± 0.13 UP *** UP ***
C16: 1 C16: 1 4,57 ± 0,44 11.01 ± 0.55 UP ***
C17: 0 0,42 ± 0.04 0,77 ± 0,02 UP **
С17:1 0,54 ± 0.05 1.10 ± 0,09 UP ***
C18: 0 3,60 ± 0,76 5.02 ± 0,03 UP *
C18: 1N9T 0 0 — —
C18: 1N9C 5.20 ± 0,71 10.02 ± 0,56 UP ***
C18: 2N6T 0 0 —-
C18: 2n6c 0,52 ± 0,04 0,55 ± 0.02 NS NS
C18: 3N6 0,25 ± 0,261 0,26 ± 0,01 UP *
C18: 3N3 0 0 —-
C20: 0 0 0.20 ± 0.02 0,21 ± 0,01 до NS
C20: 1 0 0 —-
C20: 2 C20: 2 0,68 ± 0,0005 0,66 ± 0.05 NS NS
C21: 0 0 0 —- —-
C20: 3n6 0,484 ± 0,03 0,485 ± 0,02 до нс
C20: 4n6 1.61 ± 0.23 1,65 ± 0.11 NS
C20: 3N3 0 0 —-
C20: 5n3 0,53 ± 0,05 0.55 ± 0,04 UP NS NS
C22: 0 0.168 ± 0,005 0.174 ± 0,003 до NS
C22: 1n9 0 0
C22: 2n6 0 0 —-
C23: 0 C23: 0 0 0 —-
C24: 0 0,25 ± 0.01 0,26 ± 0.005 NS
C24: 1 0 0 —-
C22: 6 0.846 ± 0,05 0,853 ± 0,03 до Н. С.
общая 29,17 ± 2,60 54,02 ± 0,97 до
SFA 13,94 ± 1,09 26,88 ± 0,02 UP *** UP ***
MUFA 10,3 ± 1,15 22.13 ± 1,20 UP ***
PUFA 4,92 ± 0,40294 5.01 ± 0.25 UP NS
C16:0/C16:1 1.82 ± 0.090 1,65 ± 0,094 NS NS
C16: 0 / C18: 0 2,37 ± 0 3,62 ± 0,044 UP *
C18: 0 / C18: 1 0,69 ± 0,057 0,50294 0.50 ± 0,026
C16: 1 / C18: 1 0,89 ± 0,074 1.10 ± 0,0070 UP **
SFA / всего 0,48 ± 0,0065 0,50 ± 0,0091 Вверх *
МНЖК/всего 0.35 ± 0.0081 0,41 ± 0,015 UP **
PUFA / всего 0,17 ± 0,0068 0,093 ± 0,0061 Down ***

Таблица 2. миР-126b-5p регулировала состав жирных кислот в паховой жировой ткани.

Таблица 2. миР-126b-5p регулировала состав жирных кислот в паховой жировой ткани.

** Н.С. Н.С. Н.С. ** Н.С. ** Н.С. —- —- Н.С. Н.С. ** Н.С.
Жирная кислота Концентрация (мкг / г) вверх / вниз
H-NC H-126 H-126
C6: 0 27.84 ± 2,75 28,85 ± 0,66 NS
С8: 0 9,84 ± 0,19 11,82 ± 0,80 до *
С10: 0 49,24 ± 2,76 68,67 ± 3,51 до
С11: 0 1,04 ± 0,14 1,19 ± 0,02
С12: 0 299,48 ± 25,58 335,03 ± 35,38
С13: 0 6.11 ± 0,74 6,86 ± 0,02 NS
С14: 0 6586,37 ± 365,78 7352,71 ± 133,51 до *
С14: 1 320,40 ± 29,42 342,04 ± 5,08 Н.С.
С15: 0 341,88 ± 11,10 333,69 ± 5,41
С15: 1 0,75 ± 0,27 2,01 ± 0,13 до
С16: 0 67 993.57 ± 1538,06 64,103.13 ± 3242,12
С16: 1 21,977.17 ± 844,14 25,118.60 ± 333,46 до
С17: 0 622,01 ± 26,90 636,70 ± 2.65 NS
C17: 1 836,88 ± 6,36 835,63 ± 17,52 NS
С18: 0 20,838.49 ± 9,99 26,268.43 ± 227,55 Up ***
C18:1n9t 0 0 —-
C18:1n9c 118 554.11 ± 1652,67 117,502.15 ± 3730,93
С18: 2n6t 0 0
С18: 2n6c 60,435.67 ± 402,57 58,232.17 ± 2572.42 Н.С.
С18: 3n6 0 0
С18: 3n3 4034,85 ± 94,16 4145,20 ± 39,24
С20: 0 576.07 ± 29,08 646,11 ± 6,99 до *
С20: 1 3601,34 ± 35,07 3583,60 ± 19,50 NS
С20: 2 1420,30 ± 12,40 1459,13 ± 4,35 Down **
C21: 0 0 0 —-
C20: 3N6 536.93 ± 22.31 556.34 ± 1.11 NS
C20: 4n6 685.24 ± 10,66 821,83 ± 46,59 Up **
C20: 3n3 200,46 ± 5,48 201,28 ± 1,71 NS
C20: 5n3 182,35 ± 13,88 154,11 ± 1,73 Вниз *
C22: 0 95,49 ± 3,51 103,27 ± 1,26 до *
C22: 1N9 170,41 ± 0,57 171,81 ± 3,16 до NS
С22:2n6 8.83 ± 0.33 10.0294 10.0294 10.20 ± 0.19 UP **
C23: 0 15.42 ± 1.45 19.39 ± 1,35 UP *
C24: 0 C24: 0 64.93 ± 4,91 Up **
C24: 1 107,11 ± 4,00 106,56 ± 0,61 NS
C22: 6 905,71 ± 80,71 876,80 ± 49,26 NS
всего 311 475.65 ± 4127,86 314,100.24 ± 2094,52 NS
SFA 97,497.15 ± 1739,71 99,980.78 ± 3565,31 NS
MUFA 145,568.17 ± 2210,44 147,662.40 ± 4110,32 NS
ПНЖК 68,410.34 ± 519,11 66,457.06 ± 2638,75
С16: 0 / С16: 1 3,10 ± 0,10 2,55 ± 0,16 Вниз **
С16: 0 / С18 :0 3.26 ± 0.073 294 ± 0.10 Down ***
C18: 0 / C18: 1 0,18 ± 0,0024 0,22 ± 0,0090 UP ***
C16: 1 / C18 : 1 0,19 ± 0,0063 0,21 ± 0,0040 до
SFA / всего 0,31 ± 0,0016 0,32 ± 0,0092
MUFA / всего 0,47 ± 0,0023 0,47 ± 0,016 NS
ПНЖК/всего 0.22 ± 0,0024 0,21 ± 0,0070 НС

Таблица 3. Последовательности праймеров для qRT-PCR и температура отжига.

Таблица 3. Последовательности праймеров для qRT-PCR и температура отжига.

циклин D1 60984
Джин Последовательности праймеров (5 ‘→ 3’) ТМ (° С)
β-актина F: GTGACGTTGACATCCGTAAAGA 60
Р: GCCGGACTCATCGTACTCC
U6 F: CTCGCTTCGGCAGCACA 60
Р: AACGCTTCACGAATTTGCGT
С / EBPα F: GCGGGAACGCAACAACATC 62
Р: GTCACTGGTCAACTCCAGCAC
CDK4 F: GTCAGTTTCTAAGCGGCCTG 60
Р: CACGGGTGTTGCGTATGTAG
FABP4 F: AAGGTGAAGAGCATCATAACCCT 52
Р: TCACGCCTTTCATAACACATTCC
SCD-1 F: TTCTTGCGATACACTCTGGTGC 63.3
Р: CGGGATTGAATGTTCTTGTCGT
ACADL F: TGCCCTATATTGCGAATTACGG 63,3
Р: CTATGGCACCGATACACTTGC
ACOX2 F: CATCCAACGTGACCCAGTGTT 63,3
Р: AAATGCGTTCAGGACCGTCTT
CDK2 F: GCGACCTCCTCCCAATATCG 60294 60276 R: GTCTGATCTTTTTCCCCAACTCT
LPL F: GGTTGCGCGTAGAGAGGATG 59.6
Р: CTCACGCTCTGACATGCCTTC
PPAR, F: TACTGCCGTTTTCACAAGTGC 62
Р: AGGTCGTGTTCACAGGTAAGA
Adipor2 F: TGTTCCTCTTAATCCTGCCCA 52,8
Р: CCAACCTGCACAAGTTCCCTT
ФАС F: AGGTGGACTGGATACACAGAC 62
Р: TCTCCTGCCCAAACTCTTTGC
циклин Е1 F: CTCCGACCTTTCAGTCCGC 60
Р: CACAGTCTTGTCAATCTTGGCA
р21 F: GATGGCTTCGACACCATTCC 60
Р: AGACGACACAGGTGAGGAAG
F: CTCCGTATCTTACTTCAAGTGCG 60
Р: CTTCTCGGCAGTCAAGGGAA
р53 F: CTCTCCCCCGCAAAAGAAAAA 60
R: CGGAACATCTCGAAGCGTTTA
MMU-MIR-126B-5P ATTATTTTATTCACGGGGGGTACGAGAGTT 60294

Высота MIR-185-5P AllViates высокого жира индуцированного диетами атеросклероза и накопление липидов in vivo и in vitro через активацию SREBP2

Авторские права: © 2022 Tan et al.Это статья с открытым доступом, распространяемая в соответствии с лицензией Creative Commons Attribution License (CC BY 3.0), которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания оригинального автора и источника.

Аннотация

Цель: SREBP2, член семейства SREBP , является первичным регулятором метаболизма липидов. В последние годы все больше исследований предполагают, что miRNAs регулируют гены, связанные с метаболизмом липидов.В этом исследовании предполагалось, что микроРНК могут участвовать в регуляции накопления липидов в макрофагах с помощью белка SREBP2.

Методы и результаты. Наборы данных GSE34812, GSE132651 и GSE28829, состоящие из образцов атеросклероза, были загружены для изучения профилей экспрессии генов, связанных с miRNAs и SREBP2, и было предсказано, что miR-185-5p будет мишенью SREBP2. Аннотации GO и анализ пути KEGG были приняты для функциональной классификации дифференциально экспрессируемых генов, а процесс метаболизма липидов был обогащенным путем при атеросклерозе.Кроме того, эффекты SREBP2 на увеличение накопления липидов исследовали in vivo с использованием мышей miR-185-5p mimic/apoE -/- и мышей miR-185-5p NC/apoE -/- . Все мыши, которых кормили HFD, страдали атеросклерозом. Кроме того, было проанализировано влияние miR-185-5p на образование атеросклеротических бляшек у мышей. Также был проведен анализ in vitro для определения влияния miR-185-5p на макрофаги RAW 264.7, стимулированные ox-LDL. Наконец, миметик miR-185-5p трансфицировали в культивируемые макрофаги.Результаты показали, что повышение уровня miR-185-5p может регулировать накопление липидов у мышей путем нацеливания на SREBP2. Кроме того, миметик miR-185-5p подавлял активацию SREBP1, SREBP2, LDLR, SCD-1, HMGCR, а также NLRP3, IL-1β, TNF-α у мышей, получавших HFD, или макрофагов, стимулированных ox-LDL.

Выводы: наше исследование показало, что миР-185-5p эффективно облегчает атеросклероз и накопление липидов путем регуляции оси миР-185-5p/SREBP2.

Введение

Атеросклероз представляет собой воспалительное заболевание, вызванное гиперкалорийной диетой с высоким содержанием жиров (HFD) и в первую очередь опосредованное инфильтрацией макрофагов в артериальную стенку [1, 2].Это ведущая причина заболеваемости и смертности во всем мире, характеризующаяся образованием артериальных бляшек [3, 4]. Кроме того, атеросклероз приводит к большинству сердечно-сосудистых заболеваний, в том числе к острому инфаркту миокарда, и способствует увеличению смертности от сердечно-сосудистых заболеваний [5, 6]. Сообщалось, что повышенное накопление липидов играет решающую роль в прогрессировании атеросклероза [7, 8]. Подтверждена способность окисленных липопротеинов низкой плотности (ox-LDL) вызывать воспалительные реакции при формировании и прогрессировании атеросклероза [9].Несмотря на значительный прогресс в методах лечения атеросклероза, это заболевание остается основной причиной заболеваемости и смертности во всем мире. Поэтому крайне необходимо изучить молекулярные механизмы атеросклероза и определить новые мишени для лечения.

МикроРНК (миРНК) представляют собой класс малых эндогенных некодирующих РНК длиной 21–24 нуклеотида, которые могут связываться с 3′-нетранслируемой областью (3′-UTR) своих мРНК-мишеней и участвовать в регуляции многих биологических процессов, таких как дифференцировка клеток, пролиферация, гомеостаз, ангиогенез и туморогенез [10-12].Кроме того, было доказано, что микроРНК играют важную роль в развитии атеросклероза. Например, Шобер и др. показали, что miR-126-5p предотвращает образование атеросклеротических поражений, регулируя оборот EC [13]. Между тем, miR-15a оказалась противовоспалительным фактором образования пенистых клеток, ассоциированного с атеросклерозом [14]. Йебенес и др. показало, что ингибирование miR-217 в сосудистой сети может частично защищать сосудистую функцию и уменьшать атеросклероз [15]. Кроме того, Чжан и др. . обнаружили, что терапия, нацеленная на miR-155, в сочетании с существующими традиционными методами лечения может служить эффективным средством лечения атеросклероза [16]. Чжан и др. показали, что лечение антисмысловыми олигонуклеотидами против миР-144 может усиливать обратный транспорт холестерина и метаболизм оксистерола у пациентов с сердечно-сосудистыми заболеваниями [17]. Кроме того, Ван и соавт. обнаружили, что miR-296 играет важную роль в регуляции атеросклероза [18]. Более ранние исследования показали, что miR-185-5p действует как супрессор опухоли и экспрессируется при многих видах рака человека [19–21].Однако молекулярный механизм miR-185-5p при атеросклерозе остается неясным. Белок 2, связывающий элемент ответа на стерол (SREBP2), член семейства SREBP , является важным регулятором метаболизма липидов [22, 23]. В последние годы все больше исследований предполагают, что микроРНК участвуют в регуляции генов, связанных с метаболизмом липидов [24]. В настоящем исследовании была изучена предполагаемая роль miR-185-5p в регуляции метаболизма липидов и его основных механизмов при атеросклерозе, чтобы предложить новые стратегии лечения атеросклероза.

Материалы и методы

Анализ данных микрочипов

Профили экспрессии генов в наборах данных GSE34812, GSE132651 и GSE28829 были загружены из базы данных Gene Expression Omnibus (GEO).Дифференциально экспрессируемые гены (DEG) были получены посредством дифференциального анализа с |logFC|>2 и padj.

Образцы человека

Все человеческие образцы каротидных атеросклеротических бляшек были собраны у пациентов первой дочерней больницы Хэбэйского медицинского университета, и все экспериментальные операции проводились в соответствии с этическими нормами, более того, подробная информация об этих пациентах была показана в дополнительной таблице 1.

Мыши

Восемнадцать самцов мышей apoE -/- на фоне C57BL/6J в возрасте 6-8 недель были приобретены в Центре экспериментальных животных Skbex Biotechnology.Мышей кормили HFD (18% жира и 1,25% холестерина) в течение 3 месяцев, как описано ранее, для индукции атеросклероза [13]. Все эксперименты на животных были одобрены Комитетом по этике Первой больницы Хэбэйского медицинского университета. Впоследствии мышей случайным образом разделили на две группы, а именно группу миметиков miR-185-5p и группу отрицательного контроля (NC) miR-185-5p, по 9 мышей в каждой группе, а затем им внутривенно вводили 100 нМ miR- 185-5p mimic и NC miRNA соответственно через хвостовые вены через день по методике Ye Yao [25].Результаты вмешательства были выявлены через 12 недель. Наконец, мышей подвергали эвтаназии путем внутрибрюшинной инъекции пентобарбитала натрия (50 мг/кг).

Окрашивание Oil Red O и патологоанатомическая оценка, а также уровни холестерина в печени и сыворотке

Сосудистые ткани брюшной полости были собраны у мышей, которые были продольно рассечены, немедленно заморожены и трижды промыты в PBS с последующим вымачиванием в 4% параформальдегиде в течение 20 минут и окрашиванием Oil Red O (Service Biology, Ухань, Хубэй, Китай). при комнатной температуре в течение 2 ч.Далее изображения визуализировали с помощью микроскопа Nikon Eclipse 80I, оснащенного камерой Nikon DS-EI1 (Nikon, Япония). Замороженные срезы корня аорты окрашивали Oil Red O для оценки площади атеросклеротических бляшек, а иммуногистохимическое окрашивание на MAC-3 и α-SMA использовали для анализа областей поврежденных макрофагов и гладкомышечных клеток (ГМК). Кроме того, для оценки содержания коллагена применяли окрашивание Sirius Red и фотографирование в поляризованном свете. Гомогенат печени, а также уровни холестерина в сыворотке тестировали с помощью набора для определения общего холестерина (ТС) у мышей ELISA (EK-Bioscience, Шанхай, Китай).

Вестерн-блоттинг

Ткани и клетки были подготовлены для вестерн-блоттинга, как описано в предыдущем исследовании [26].Первичные и вторичные антитела наносили для инкубации тканей и клеток при комнатной температуре в течение 2 часов. В частности, в качестве контроля белков, полученных из тканей и клеток, был взят β-актин (разведение 1:5000). Все антитела против SREBP1 и SREBP2 (разведение 1:1000), рецептора ЛПНП (LDLR) (разведение 1:1000), Fas (разведение 1:2000), стеароил-КоА-десатуразы 1 (SCD-1) и 3-гидрокси- 3-Метилглутарил-КоА-редуктазу (HMGCR) приобретали у Abcam. Наконец, белки были обнаружены с использованием набора для вестерн-блоттинга с усиленной хемилюминесценцией (ECL) (Amersham Life Sciences, Великобритания).

Приготовление ядерных экстрактов из атеросклеротических тканей

Тканевую суспензию центрифугировали при 3000 g в течение 5 мин.Осадок ресуспендировали с 5 мл гомогената, переносили в ступку и растирали до гомогената. Затем гомогенат дважды фильтровали через двухслойный Miracloth, переносили в пробирку Falcon объемом 15 мл и центрифугировали при 1000 g в течение 10 мин. После этого осадок осторожно ресуспендировали с гомогенатом и помещали поверх градиентного раствора сахарозы с концентрацией 2,0 моль/л, содержащего 37,5 ммоль/л трис-малеиновой кислоты (рН 6,5), 5 ммоль/л MgCl2 и 1% декстрина Т500, после чего центрифугирование при 50000 g и 4°С в течение 30 мин.После осторожного удаления супернатанта осадок снова осторожно ресуспендировали с 5 мл гомогената, ресуспензию помещали поверх градиентного раствора сахарозы 2,0 моль/л и центрифугировали при 50000 g в течение 30 мин. Наконец, осадки, содержащие ядра, ресуспендировали с использованием 100 нМ гомогената, а суспензию, содержащую ядра, использовали для выделения ядерных белков.

Культура клеток и обработка

РАВ 264.7 клеток поддерживали в среде DMEM (Thermo Fisher Scientific, США), содержащей 10% эмбриональную бычью сыворотку (FBS, Wisent, Канада), 100 мкг/мл пенициллина и 100 мкг/мл сульфата стрептомицина. После достижения 80-90% слияния клетки RAW 264.7 трансфицировали в соответствии с инструкциями Lipofectamine 2000 (11668-019, Invitrogen, Карлсбад, Калифорния, США). Впоследствии клетки RAW 264.7 котрансфицировали 75 мкг/мл ox-LDL (YB-002, Yiyuan Biotech, Гуанчжоу, Гуандун, Китай), miR-185-5p NC, miR-185-5p mimic или miR-185- Ингибитор 5р.Лентивирус со сверхэкспрессией (OE) SREBP2, миметик miR-185-5p и ингибитор miR-185-5p были получены от Beijing Syngentech Co., Ltd. (Пекин, Китай).

Иммунофлуоресцентное окрашивание

Собирали

листа для лазания клеток, трижды промывали PBS, фиксировали в 4% параформальдегиде в течение 30 минут при комнатной температуре и пермеабилизировали с помощью 0.1% Triton X-100 и блокировали 5% BSA плюс Tween 20. Затем срезы инкубировали с антителом против SREBP2 (разведение 1:100, Abcam) в течение ночи при 4°C, после чего инкубировали 1 ч со вторичным антитела при комнатной температуре. Затем ядра докрашивали DAPI (разведение 1:1000, Thermo Fisher Scientific) в течение 10 минут при комнатной температуре. Наконец, интенсивность флуоресценции на окрашенных срезах корней аорты измеряли с помощью программного обеспечения ImageJ.

Обнаружение фагоцитоза латексных шариков с помощью RAW 264.7 ячеек

Клеточная линия мышиных макрофагов RAW 264.7, инфицированная NC, миметиком или ингибитором miR-185-5p, высевали на покровное стекло и инкубировали с 75 мкг/мл ox-LDL, а также латексными шариками или микросферами Fluoresbrite YG Microsphere размером 1 мкм. (Polysciences; 4,55 × 10 6 гранул на мл) в течение 24 часов. Затем покровное стекло с клетками окрашивали DAPI для визуализации ядер и Dil для визуализации мембран согласно инструкции.Цифровые изображения были получены под флуоресцентным микроскопом при различных длинах волн возбуждения для идентификации латексных шариков для дальнейшего количественного анализа числа латексных шариков, фагоцитированных макрофагами. Количество латексных шариков и ядер подсчитывали в пяти случайно выбранных полях при каждом экспериментальном условии. Фагоцитарную активность выражали как отношение числа латексных шариков к числу ядер в полях [27].

Результаты

Влияние SREBP2 и миР-185-5p на атеросклероз

Для определения мРНК, которые могут способствовать прогрессированию атеросклероза, профили экспрессии генов в наборах данных GSE43292, GSE132651 и GSE28829 были получены из базы данных GEO, состоящей из образцов атеросклероза, а образцы с недостаточными клиническими данными были проигнорированы.Были получены 100 лучших DEG в этих наборах данных. Затем был проведен анализ диаграммы Венна, чтобы визуализировать перекрывающиеся DEG среди этих наборов данных, включая SREBP2, LDLR и Fas (рис. 1А). Тепловая карта, изображающая 50 лучших DEG из набора данных GSE132651, была показана на рисунке 1B. Тепловая карта, изображающая DEG из набора данных GSE43292, была показана на рисунке 1C. Тепловая карта, изображающая DEG из набора данных GSE28829, представлена ​​на рисунке 1D. Затем предполагаемые микроРНК, нацеленные на SREBP2, были определены с помощью инструментов TargetScan, miRDB, miRWalk и DIANA.Путем оценки 50 лучших миРНК с каждого веб-сайта прогнозирования миРНК-185-5p была идентифицирована как обычная прогностическая миРНК. Кроме того, были предсказаны SREBP2 и miRNA соответственно, и для получения пересечения использовалась диаграмма Уэйна (рис. 1E). В частности, путем сравнения результатов прогнозирования было обнаружено, что miR-185-5p имеет целевые области связывания с SREBP2 (рис. 1F). SREBP2 был идентифицирован как ген с высокой экспрессией при атеросклерозе в соответствии с данными из набора данных GSE132651 (рис. 1G), что позволяет предположить, что SREBP2 может влиять на развитие атеросклероза.Уровни miR-185-5p были протестированы с помощью Q-PCR в атеросклеротических бляшках и окружающих тканях, и уровни miR-185-5p были намного ниже в бляшках AS (рис. 1H). Чтобы дополнительно объяснить изменения экспрессии генов при атеросклерозе, была проведена функциональная классификация DEG с помощью аннотаций Gene Ontology (GO) и анализа путей Киотской энциклопедии генов и геномов (KEGG). Согласно данным из набора данных GSE132651, процессы обогащения аннотаций GO были изображены на рис. 1I, 1J.Выявлено, что ДЭГ в основном обогащались в процессе липидного обмена, воспалительной реакции и метаболическом процессе. Все дифференциальные гены, обнаруженные с помощью анализа пути KEGG, изображены на рисунке 1K. Приведенные выше результаты означают, что эффекты miR-185-5p и ее гена-мишени SREBP2 на атеросклероз могут реализовываться через липидный метаболический сигнальный путь.

Рис. 1. МиР-185-5p была предсказана как кандидат микроРНК, которая влияет на прогрессирование атеросклероза посредством регуляции SREBP2. ( A ) Диаграмма Венна перекрытия 100 лучших DGE среди наборов данных GSE43292, GSE132651 и GSE28829; ( B ) тепловая карта, отображающая 100 лучших DEG из набора данных GSE132651; ( C ) экспрессия SREBP2 при атеросклерозе в наборе данных GSE132651 (PD) 50 лучших микроРНК, предсказанных на основе четырех веб-ресурсов, и miR-185-5p продемонстрировали наивысшую статистическую оценку (PE) последовательность miR-185- связывание 5p с SREBP2, предсказанное с использованием онлайн-ресурса биологического предсказания; ( F , G ) процессы обогащения ГО аннотациями и процесс метаболизма липидов были обогащены путями при атеросклерозе; ( H ) Уровни miR-185-5P в образцах человека тестировали с помощью Q-PCR; ( I , J ) Анализ обогащения GSEA показывает, что он обогащен липидным метаболическим сигнальным путем, ( K ) Результаты анализа пути KEGG показали все дифференциальные гены.

MiR-185-5p имитирует повышение уровня холестерина в сыворотке, но снижение уровня холестерина в печени и подавление атеросклероза у мышей, получавших HFD apoE

-/-

Повышенные уровни холестерина в сыворотке и сниженные уровни холестерина в печени были обнаружены у мышей-миметиков miR-185-5p по сравнению с группой miR-185-5p NC, результаты показаны на рисунке 2A.Чтобы исследовать влияние миР-185-5p на атеросклероз, мы кормили мышей apoE -/- диетой с высоким содержанием жиров, чтобы вызвать атеросклероз. Как показано на фигуре 2B, было обнаружено, что миметик miR-185-5p уменьшает образование бляшек в нисходящих артериях мышей apoE -/- с помощью окрашивания Oil-red-O. Количественный анализ также подтвердил, что у мышей, мимикрирующих miR-185-5p, наблюдалось более низкое соотношение бляшек (положительная площадь/общая площадь аорты), чем у мышей в группе NC (рис. 2C, площадь поражения корня аорты продемонстрировала, что miR-185-5p значительно имитирует уменьшилась площадь поражения.Кроме того, миметик miR-185-5p также приводил к снижению соотношения бляшек (положительная площадь/площадь просвета аорты), наблюдаемому в срезах корня аорты, окрашенных Oil-red-O, по сравнению с таковыми в группе NC (мыши P-/-.

).

Рис. 2. MiR-185-5p имитирует уменьшение атеросклеротических поражений у мышей apoE -/- , получавших HFD. Чтобы вызвать атеросклероз, мышам apoE -/- , получавшим диету с высоким содержанием жиров, вводили миметик miR-185-5p через хвостовую вену один раз каждые 2 недели в течение 12 недель. ( A ) уровни холестерина в печени и уровни холестерина в сыворотке, ( B ) Нисходящие артерии получали от мышей apoE -/- и окрашивали Oil-red-O для изучения образования бляшек. ( C ) Продольный срез корня аорты мышей окрашивали масляным красным O для изучения области поражения.

МиР-185-5p имитирует подавляющую регуляцию гена метаболизма липидов, а также экспрессию воспалительных факторов у мышей, получавших HFD апоЕ

-/-

Чтобы изучить влияние MiR-185-5p на метаболизм липидов на молекулярном уровне, оценивали экспрессию важных регуляторов, участвующих в процессах метаболизма липидов.Во-первых, анализ обогащения GSEA предсказал, что аномальная регуляция основных дифференциальных генов связана с некоторыми важными биологическими процессами. Аннотированные наборы генов были c2.cp.reactome.v7.4.symbols.gmt и c5.go.bp.v7.4symbols.gmt. По величине Р отбирали пути со значительным обогащением различий и в качестве возможных путей отбирали пути, ингибируемые двумя генами. Результаты показывают, что он обогащен сигнальными путями, такими как путь метаболизма липидов (рис. 1А, 1В).Кроме того, анализ совместной экспрессии показал, что LDLR и FAS значительно коррелируют с SREBP2 при атеросклерозе (рис. 3C, 3D). Затем мы исследовали экспрессию мРНК и белков LDLR, FAS и SREBP2, а также SREBP1, SCD1, HMGCR, липидных метаболических белков [25, 26, 28, 29] в поражениях атеросклеротических аорт у ароЕ-/- мышей. с HFD в ткани, а также ядерные белки, показанные на рисунке 3E, 3F. SREBP2 напрямую сочетается с активацией NLRP3, мощного активатора воспаления при АС, поэтому ассоциированные воспалительные факторы IL-1β, TNF-α также были протестированы вестерн-блоттингом.Миметик miR-185-5p ингибировал эти биосинтез липидов и воспалительные факторы по сравнению с мышами miR-185-5p NC, данные представлены на рисунках 3E-3G (P

Рисунок 3. МиР-185-5p имитирует ингибированную экспрессию генов метаболизма липидов у мышей apoE -/- , получавших HFD. ( A , B ) Анализ обогащения GSEA показывает, что он обогащен липидным метаболическим сигнальным путем. ( C , D ) анализ совместной экспрессии показал, что LDLR и FAS значительно коррелируют с SREBP2 при атеросклерозе. ( E , G ) Вестерн-блоттинг и анализ Q-PCR проводили для оценки уровней белков LDLR, FAS и SREBP2, SREBP1, SCD1, HMGCR, NLRP3, IL-1β, TNF-α в отделах аорты. мышей apoE -/- , получавших HFD.( F ) уровни ядерных белков SREBP1 и 2. ( H ) вестерн-блоттинг для проверки уровней белков NLRP3, IL-1β, TNF-α. (*,Р).

МиР-185-5p ингибировала путь метаболизма липидов путем подавления активации SREBP2

Затем было специально изучено влияние miR-185-5p на SREBP2 in vitro .Клеточная линия макрофагов RAW 264.7 была обработана ox-LDL, а также NC, миметиком и ингибитором miR-185-5p. Положительная экспрессия SREBP2 была увеличена в макрофагах, подвергшихся воздействию ox-LDL. С помощью иммунофлуоресцентного окрашивания было обнаружено, что введение миметика miR-185-5p значительно снижало экспрессию SREBP2 в ox-LDL-стимулированных макрофагах, тогда как сниженная экспрессия SREBP2 значительно восстанавливалась после предварительной обработки ингибитором miR-185-5p. (Рисунок 4А). Впоследствии с помощью количественного анализа было продемонстрировано, что интенсивность иммунофлуоресценции SREBP2 в макрофагах, стимулированных ox-LDL, была снижена в группе миметиков miR-185-5p по сравнению с таковой в группе miR-185-5p NC и группе ингибиторов miR-185-5p. (P Figure 4B), предполагая, что миР-185-5p регулирует уровни белка генов, связанных с метаболизмом липидов, посредством SREBP2 в макрофагах, стимулированных ox-LDL.Таким образом, эти результаты свидетельствуют о том, что миР-185-5p ингибирует уровни белка генов, связанных с метаболизмом липидов, через SREBP2 в макрофагах, стимулированных ox-LDL.

Рис. 4. МиР-185-5p ингибировала активацию SREBP2 и, таким образом, подавляла путь метаболизма липидов. Макрофаги предварительно обрабатывали стимуляцией ox-LDL. ( A ) Иммуногистохимическое окрашивание SREBP2 в группе миметиков miR-185-5p, группе ингибиторов и группе отрицательного контроля; положительная скорость экспрессии SREBP2. *PB) Вестерн-блоттинг анализ SREBP2, LDLR и FAS в группе miR-185-5p NC, группе миметиков miR-185-5p или группе ингибиторов miR-185-5p. Уровни белков SREBP2, LDLR и FAS, SREBP1, SCD1, HMGCR измеряли после совместной трансфекции миметиком miR-185-5p, NC miR-185-5p или ингибитором miR-185-5p и лентивирусом SREBP2-OE в макрофаги, стимулированные ox-LDL.Различные данные были представлены как среднее значение ± стандартное отклонение. (*,Р).

Влияние миметика MiR-185-5p на накопление липидов в макрофагах

Последующий анализ был проведен, чтобы выяснить, снижает ли миметик miR-185-5p накопление липидов in vitro .После воздействия ox-LDL в течение 48 часов количество липидных капель в макрофагах увеличилось, о чем свидетельствует окрашивание Oil Red O. Совместное лечение миметиком miR-185-5p и ox-LDL значительно уменьшало количество липидных капель в отличие от результатов, полученных в группе miR-185-5p NC. Кроме того, ингибитор миР-185-5p заметно увеличивал количество липидных капель в макрофагах (рис. 5А). Количественный анализ показал, что процент положительных клеток Oil Red O был ниже в группе миметиков miR-185-5p, чем в группах miR-185-5p NC и ингибиторов.Анализы фагоцитоза микросфер были выполнены для изучения влияния miR-185-5p на способность макрофагов к эффероцитозу. Количественно определяли содержание микросфер в макрофагах, стимулированных ox-LDL. Было показано, что значительно меньшее количество флуоресцентных микросфер проникло в макрофаги в группе миметиков miR-185-5p. Артериосклеротическая среда приводила к ускоренному рекрутированию микросфер в макрофаги, тогда как такое рекрутирование значительно сдерживалось миметиком miR-185-5p.Напротив, ингибитор miR-185-5p усиливал рекрутирование микросфер в макрофаги. Количественный анализ подтвердил, что инфильтрация флуоресцентных микросфер была слабее в группе миметиков miR-185-5p по сравнению с группой ингибиторов miR-185-5p и группой miR-185-5p NC (P

Рисунок 5. Влияние миметика miR-185-5p на накопление липидов в макрофагах. Макрофаги предварительно обрабатывали стимуляцией ox-LDL. ( A ) Окрашивание Oil Red O показало, что совместная обработка миметиком miR-185-5p и ox-LDL значительно уменьшала количество липидных капель. Ингибитор миР-185-5p заметно увеличивал количество липидных капель в макрофагах. ( B ) Анализы фагоцитоза микросфер показали, что значительно меньше флуоресцентных микросфер проникло в макрофаги в группе миметиков miR-185-5p.Ингибитор MiR-185-5p усиливал привлечение микросфер в макрофаги (*,P).

Обсуждение

В этом исследовании эффекты miR-185-5p на ослабление артериосклероза и накопление липидов изучали с использованием мышей apoE -/- , получавших HFD, и макрофагов, стимулированных ox-LDL.Наши результаты показали, что miR-185-5p имитирует уменьшение образования бляшек в нисходящих артериях и уменьшение областей поражения тканей корня аорты. На молекулярном уровне миР-185-5p снижала экспрессию генов, связанных с метаболизмом липидов, путем ингибирования активации SREBP-2, подтверждая тем самым критическую роль миР-185-5p для клинического применения в качестве липидорегулирующего агента при лечении атеросклероза и связанных с ним заболеваний. нарушения липидного обмена.

С помощью биоинформатического анализа было продемонстрировано, что SREBP-2 участвует в патогенезе атеросклероза.Анализ биологического предсказания показал, что miR-185-5p может связываться с SREBP-2, и между miR-185-5p и SREBP-2 существует взаимосвязь нацеливания. Аннотации GO и анализ пути KEGG были проведены на основе данных из набора данных GSE132651. Выявлено, что ДЭГ обогащались в процессе липидного обмена. Этот вывод предполагает, что эффекты miR-185-5p и ее целевого гена SREBP2 на атеросклероз могут быть достигнуты посредством липидного метаболического сигнального пути.

Чтобы изучить регуляторный эффект miR-185-5p на атеросклероз, экспериментов in vivo было проведено на мышах apoE -/- , получавших HFD, получавших миметик miR-185-5p и NC.МиР-185-5p является мощным модулятором холестерина, особенно в метаболизме липидов в печени, который может эффективно подавлять экспрессию печеночного SREBP2, а также нижестоящие гены LDLR и SR-BI, тем самым предотвращая проникновение сывороточных ЛПНП в гепатоциты для дальнейшего накопление липидов в печени и, возможно, приводящее к повышению уровня ЛПНП и свободных жирных кислот в сыворотке [25, 26]. Кроме того, результаты этого исследования показали, что уровни ТС и ТГ в сыворотке были повышены при снижении уровня холестерина в печени в miR-185. -5p миметическая группа в отличие от группы miR-185-5p NC, что ясно подтверждает, что miR-185-5p ингибирует прогрессирование артериосклероза путем подавления метаболизма липидов в макрофагах [30-34].Окрашивание Oil Red O показало, что miR-185-5p имитирует уменьшение образования бляшек в нисходящих артериях мышей apoE -/- . Для дальнейшей оценки влияния миР-185-5p на атеросклероз было проведено окрашивание масляным красным O на продольно рассеченной аорте, и было продемонстрировано, что миметик миР-185-5p уменьшал площадь поражения и соотношение бляшек в апоЕ , питаемом HFD. -/- мышей. Более того, атеросклероз считается типом гиперлипидемии, вызванной воспалительными заболеваниями, накопление липидов в макрофагах активирует SREBP2 и родственный NLRP3, основной воспалительный стимулятор, способный усиливать воспалительную реакцию и приводить к ухудшению атеросклероза [35].Метаболизм липидов и воспаление, связанные с атеросклерозом в этом исследовании, могут быть связаны с модуляцией SREBP2 с помощью miR-185-5p.

Затем было исследовано влияние miR-185-5p на метаболизм липидов на молекулярном уровне. Оценивали экспрессию основных регуляторов, участвующих в процессах метаболизма липидов.GSEA на наборе данных GSE132651 показал, что обогащение метаболизма липидов и регуляция развития эпидермиса, по-видимому, функционально обогащаются активацией передачи сигналов SREBP2 (рис. 3A, 3B). Кроме того, анализ коэкспрессии показал, что LDLR и Fas значительно коррелируют с SREBP2 при атеросклерозе. Q-ПЦР, Вестерн-блоттинг показал, что HFD увеличивает уровни мРНК и белков LDLR, Fas, SREBP2, SCD-1 и HMGCR у мышей apoE -/- , тогда как miR-185-5p имитирует такие экспрессии.Эти результаты согласуются с результатами биоинформатического анализа. Эти регуляторные белки биосинтеза холестерина ответственны за накопление холестерина ЛПНП в пораженных макрофагах [28]. Результаты настоящего исследования показали, что миР-185-5p ингибирует области, окрашенные Oil Red O/области накопления липидов, путем ингибирования белков, связанных с SREBP-2.

Для дальнейшего подтверждения механизмов супрессивного эффекта миметика miR-185-5p на активацию SREBP2 макрофаги обрабатывали ox-LDL для создания атеросклеротической среды in vivo .Иммунофлуоресцентное окрашивание показало, что введение миметика miR-185-5p значительно снижало экспрессию SREBP2, в то время как сниженная экспрессия SREBP2 восстанавливалась ингибитором miR-185-5p. Вестерн-блоттинг анализ подтвердил, что миметик miR-185-5p снижает экспрессию белка SREBP2 и связанных с ним генов LDLR, а также FAS, SREBP1c, SCD-1 и HMGCR in vitro . Результаты были дополнительно подтверждены количественным анализом относительных уровней белка, что позволяет предположить, что миметик miR-185-5p специфически влияет на активацию генов, связанных с метаболизмом липидов, в макрофагах, стимулированных ox-LDL.SREBP2-OE эффективно обращает защитную роль miR-185-5p, а именно, ингибирует ее гены, связанные с метаболизмом липидов, посредством активации SREBP2. Таким образом, миР-185-5p подавляла отложение липидов в поврежденных макрофагах путем ингибирования SREBP2 и связанных с ним липид-модулирующих белков в случае атеросклероза.

Кроме того, окрашивание Oil Red O показало, что миметик miR-185-5p значительно снижает количество липидных капель в макрофагах, стимулированных ox-LDL.Анализы фагоцитоза микросфер дополнительно подтвердили, что артериосклеротическая среда приводила к ускоренному рекрутированию микросфер в макрофаги, но такое рекрутирование было значительно ограничено миметиком миР-185-5p, подразумевая, что эффероцитоз может быть нарушен миметиком миР-185-5p, что потенциально способствует к ингибированию накопления липидов в ox-LDL-стимулированных макрофагах.

В заключение, настоящее исследование предоставляет доказательства того, что репрессия сигнального пути метаболизма липидов, вызванная подавлением SREBP2, лежит в основе подавляющей роли miR-185-5p в прогрессировании атеросклероза.Эти выводы указывают на трансляционную ценность miR-185-5p в качестве новой терапевтической стратегии при атеросклерозе.

Сокращения

ПОКД: послеоперационная когнитивная дисфункция; IP3: инозитол-1,4,5-трифосфат; ЭР: эндоплазматический ретикулум; PKA: цАМФ-зависимая протеинкиназа; PKG: цГМФ-зависимая протеинкиназа; CaMKII: Ca 2+ /CaM-зависимая протеинкиназа II; GEO: GENE EXPRESSION OMNIBUS; ГО: онтология генов; KEGG: Киотская энциклопедия генов и геномов; gsea: анализ обогащения набора генов; H&E: гематоксилин и эозин; CytC: цитохром С; MPTP: белок канала трансформации митохондриальной проницаемости; GRP78: регуляторный белок 78 глюкозы; GRP94: регуляторный белок 94 глюкозы; CHOP: белок гомологии C/EBP; XBP1: Х-бокс-связывающий белок 1.

Вклад авторов

Концепция и дизайн: Mingqi Zheng, Gang Wang, Wenyun Tan. Административная поддержка: Минци Чжэн, Ган Лю. Материалы и образцы предоставляются: Mingqi Zheng, Gang Liu, Daofeng You, Mei Wei, Wenyun Tan. Сбор и сопоставление данных: Daofeng You, Mei Wei, Xiaojing Jin, Wenyun Tan. Анализ и интерпретация данных: Wenyun Tan.

Благодарности

Мы признательны и признательны нашим коллегам за их ценные усилия и комментарии к этому исследованию.

Конфликты интересов

Авторы заявляют об отсутствии конфликта интересов.

Финансирование

Ключевой проект Хэбэйского плана поддержки науки и технологий (№ 1

57D). Фонд естественных наук провинции Хэбэй (№ h3020206420). Ключевое медицинское исследование провинции Хэбэй (№ 20200118). Программа ключевых научно-технических исследований Комиссии по здравоохранению провинции Хэбэй (No.201).

Ссылки

  • 1. Аногианаки А., Анджелуччи Д., Чианкетти Э., Д’Алессандро М., Маккауро Г., Саггини А., Салини В., Караффа А., Тете С., Конти Ф., Триподи Д., Шайк-Дастхагирисахеб Ю.Б. Атеросклероз: классическое воспалительное заболевание. Int J Immunopathol Pharmacol. 2011 г.; 24:817–25. https://doi.org/10.1177/039463201102400401 [PubMed]
  • 2. Абдерразак А., Кучи Д., Махмуд Д.Ф., Эльхаге Р., Виндис С., Лаффарг М., Матео В., Бюхеле Б., Айяла М.Р., Эль Гаафари М., Сыровец Т., Слиман М.Н., Фриге Б. и др. Противовоспалительные и антиатерогенные эффекты ингибитора воспаления NLRP3 арглабина у мышей ApoE2.Ki, получавших диету с высоким содержанием жиров. Тираж. 2015 г.; 131:1061–70. https://doi.org/10.1161/CIRCULATIONAHA.114.013730 [PubMed]
  • 3. Jeon US, Choi JP, Kim YS, Ryu SH, Kim YK.Повышенная экспрессия IL-17-секретирующих Т-клеток во время раннего прогрессирования атеросклероза у мышей с дефицитом ApoE, получавших диету западного типа. Эксп Мол Мед. 2015 г.; 47:e163. https://doi.org/10.1038/emm.2015.19 [PubMed]
  • 4. Bessueille L, Magne D. Воспаление: виновник кальцификации сосудов при атеросклерозе и диабете. Cell Mol Life Sci. 2015 г.; 72:2475–89. https://doi.org/10.1007/s00018-015-1876-4 [PubMed]
  • 5. Сильвис М.Дж., Демкес Э.Дж., Фиолет А.Т., Деккер М., Бош Л., ван Хаут Г.П., Тиммерс Л., де Кляйн Д.П. Иммуномодуляция инфламмасомы NLRP3 при атеросклерозе, ишемической болезни сердца и остром инфаркте миокарда. J Cardiovasc Transl Res. 2021; 14:23–34. https://doi.org/10.1007/s12265-020-10049-w [PubMed]
  • 6. Редди С.К., Шетти Р., Марупуру С., Йедавалли Н., Шетти К. Значение индексов объема тромбоцитов у пациентов с ИМпST: исследование случай-контроль.J Clin Diagn Res. 2017; 11:LC05–7. https://doi.org/10.7860/JCDR/2017/24963.9622 [PubMed]
  • 7. Каул С., Сюй Х., Забалави М., Маруко Э., Фулп Б.Е., Блюмн Т., Брзоза-Льюис К.Л., Герелус М., Вирасекера Р., Каллингер Р., Джеймс Р., Чжан Ю.С., Томас М.Дж., Сорси-Томас М.Г. Безлипидный аполипопротеин A-I снижает прогрессирование атеросклероза за счет мобилизации холестерина микродоменов и ослабления количества клеток, экспрессирующих CD131: мониторинг гомеостаза холестерина с использованием отношения клеточного эфира к общему холестерину.Ассоциация J Am Heart. 2016; 5:e004401. https://doi.org/10.1161/JAHA.116.004401 [PubMed]
  • 8. Cheng WL, Yang Y, Zhang XJ, Guo J, Gong J, Gong FH, She ZG, Huang Z, Xia H, Li H. Абляция Dickkopf-3 ослабляет развитие атеросклероза у мышей с дефицитом ApoE. Ассоциация J Am Heart. 2017; 6:e004690. https://doi.org/10.1161/JAHA.116.004690 [PubMed]
  • 9. Хао С., Цзи Дж., Чжао Х., Шан Л., Ву Дж., Ли Х., Цяо Т., Ли К. Митохондриально-направленный пептид SS-31 ингибирует индуцированное окисленными липопротеинами низкой плотности образование пенистых клеток за счет удаления АФК и ингибирования холестерина. Приток в ячейках RAW264.7. Молекулы. 2015 г.; 20:21287–97. https://doi.org/10.3390/molecules201219764 [PubMed]
  • 10. Горадель Н.Х., Мохаммади Н., Хаги-Аминджан Х., Фархуд Б., Негадари Б., Сахебкар А.Регуляция опухолевого ангиогенеза с помощью микроРНК: современное состояние. J Cell Physiol. 2019; 234:1099–110. https://doi.org/10.1002/jcp.27051 [PubMed]
  • 11. Iswariya GT, Paital B, Padma PR, Nirmaladevi R. МикроРНК: эпигенетические игроки рака и старения. Front Biosci (Школьное издание). 2019; 11:29–55. https://doi.org/10.2741/S525 [PubMed]
  • 12. Чжоу Ц, Ли М, Ван С, Ли Ц, Ван Т, Чжу Ц, Чжоу С, Ван С, Гао С, Ли С.Иммунородственные микроРНК в изобилии присутствуют в экзосомах грудного молока. Int J Biol Sci. 2012 г.; 8:118–23. https://doi.org/10.7150/ijbs.8.118 [PubMed]
  • 13. Шобер А., Назари-Джаханти М., Вей Ю., Биджеков К., Гремсе Ф., Громмес Дж., Мегенс Р.Т., Хейлл К., Ноэлс Х., Христов М., Ван С., Кисслинг Ф., Олсон Е.Н., Вебер С. МикроРНК-126-5p способствует эндотелиальную пролиферацию и ограничивает атеросклероз, подавляя Dlk1. Нат Мед. 2014; 20: 368–76.https://doi.org/10.1038/nm.3487 [PubMed]
  • 14. Li X, Kong D, Chen H, Liu S, Hu H, Wu T, Wang J, Chen W, Ning Y, Li Y, Lu Z. miR-155 действует как противовоспалительный фактор в образовании пенистых клеток, связанных с атеросклерозом. путем подавления термостабильного белка, регулируемого кальцием 1. Sci Rep. 2016; 6:21789. https://doi.org/10.1038/srep21789 [PubMed]
  • 15. де Йебенес В.Г., Брионес А.М., Мартос-Фольгадо И., Мур С.М., Оллер Х., Билал Ф., Гонсалес-Амор М., Мендес-Барберо Н., Силья-Кастро Х.К., Вере Ф., Хименес-Боррегеро Л.Х., Санчес-Кабо Ф., Буэно Х и др. Связанная со старением миР-217 усугубляет атеросклероз и способствует сердечно-сосудистой дисфункции. Артериосклеры Тромб Васк Биол. 2020; 40:2408–24. https://doi.org/10.1161/ATVBAHA.120.314333 [PubMed]
  • 16. Чжэн Б., Инь В.Н., Сузуки Т., Чжан Х.Х., Чжан И., Сонг Л.Л., Джин Л.С., Чжан Х., Чжан Х., Ли Дж.С., Вэнь Дж.К.Опосредованный экзосомами перенос миР-155 из гладкомышечных клеток в эндотелиальные клетки вызывает повреждение эндотелия и способствует атеросклерозу. Мол Тер. 2017; 25:1279–94. https://doi.org/10.1016/j.ymthe.2017.03.031 [PubMed]
  • 17. Cheng J, Cheng A, Clifford BL, Wu X, Hedin U, Maegdefessel L, Pamir N, Sallam T, Tarling EJ, de Aguiar Vallim TQ. Сайленсинг микроРНК-144 защищает от атеросклероза самцов, но не самок мышей.Артериосклеры Тромб Васк Биол. 2020; 40:412–25. https://doi.org/10.1161/ATVBAHA.119.313633 [PubMed]
  • 18. Li H, Ouyang XP, Jiang T, Zheng XL, He PP, Zhao GJ. МикроРНК-296: перспективная мишень в патогенезе атеросклероза? Мол Мед. 2018; 24:12. https://doi.org/10.1186/s10020-018-0012-y [PubMed]
  • 19. Тан Зи, Цзян Х, У И, Се Л, Дай В, Тан Х, Тан С.миР-185 является независимым фактором прогноза и подавляет метастазирование опухоли при раке желудка. Мол Селл Биохим. 2014; 386: 223–31. https://doi.org/10.1007/s11010-013-1860-y [PubMed]
  • 20. Deng L, Wang X, Jiang L, Yang J, Zhou X, Lu Z, Hu H. Модуляция экспрессии miR-185-5p с помощью EBV-miR-BART6 способствует различиям в развитии экспрессии гена ABCG4 в мегакариоцитах человека. Int J Biochem Cell Biol. 2016; 81:105–11.https://doi.org/10.1016/j.biocel.2016.11.001 [PubMed]
  • 21. Ши Р., Ву П., Лю М., Чен Б., Конг Л. Нокдаун днРНК PCAT6 повышает радиочувствительность в клетках тройного негативного рака молочной железы путем регуляции оси миР-185-5p/TPD52. Onco нацеливается на Ther. 2020; 13:3025–37. https://doi.org/10.2147/OTT.S237559 [PubMed]
  • 22. Прошковец-Вегларц М., Хамфри Б.Д., Ричардс М.П.Молекулярное клонирование и экспрессия белка, связывающего элемент ответа на углеводы курицы, и гомологов гена Max-подобного белка X. Мол Селл Биохим. 2008 г.; 312: 167–84. https://doi.org/10.1007/s11010-008-9732-6 [PubMed]
  • 23. Вонг Т.И., Тан Ю.К., Лин С.М., Люн Л.К. Форбол 12-миристат 13-ацетат способствует ядерной транслокации белка-2, связывающего элемент ответа на стероиды в печени. Int J Biochem Cell Biol. 2016; 75:1–10.https://doi.org/10.1016/j.biocel.2016.03.010 [PubMed]
  • 24. Zheng Y, Zhao C, Zhang N, Kang W, Lu R, Wu H, Geng Y, Zhao Y, Xu X. Содержание микроРНК миР-206 в сыворотке снижено при гипертиреозе и опосредует регуляцию гормоном щитовидной железы метаболизма липидов в клетках гепатобластомы человека HepG2. Mol Med Rep. 2018; 17: 5635–41. https://doi.org/10.3892/mmr.2018.8633 [PubMed]
  • 25. Канг С., Дэвис Р.А. Сборка и секреция холестерина и печеночных липопротеинов. Биохим Биофиз Акта. 2000 г.; 1529: 223–30. https://doi.org/10.1016/s1388-1981(00)00151-7 [PubMed]
  • 26. Yang M, Liu W, Pellicane C, Sahyoun C, Joseph BK, Gallo-Ebert C, Donigan M, Pandya D, Giordano C, Bata A, Nickels JT Jr. Идентификация miR-185 как регулятора биосинтеза холестерина de novo и поглощение липопротеидов низкой плотности.J липидный рез. 2014; 55:226–38. https://doi.org/10.1194/jlr.M041335 [PubMed]
  • 27. Yao Y, Sun W, Sun Q, Jing B, Liu S, Liu X, Shen G, Chen R, Wang H. Полученная из тромбоцитов экзосомальная микроРНК-25-3p ингибирует воспаление эндотелиальных клеток коронарных сосудов через Adam10 посредством передачи сигналов NF-κB Путь в ApoE -/- Мыши. Фронт Иммунол. 2019; 10:2205. https://doi.org/10.3389/fimmu.2019.02205 [PubMed]
  • 28. Guo C, Chi Z, Jiang D, Xu T, Yu W, Wang Z, Chen S, Zhang L, Liu Q, Guo X, Zhang X, Li W, Lu L и другие. Гомеостатический регулятор холестерина SCAP-SREBP2 объединяет активацию воспаления NLRP3 и передачу сигналов биосинтеза холестерина в макрофагах. Иммунитет. 2018; 49:842–56.e7. https://doi.org/10.1016/j.immuni.2018.08.021 [PubMed]
  • 29. Сакаи К., Нагашима С., Вакабаяси Т., Туменбаяр Б., Хаякава Х., Хаякава М., Карасава Т., Охаси К., Ямадзаки Х., Такей А., Такей С., Ямамуро Д., Такахаши М. и др.Миелоидная ГМГ-КоА (3-гидрокси-3-метилглутарил-кофермент А) редуктаза определяет атеросклероз, модулируя миграцию макрофагов. Артериосклеры Тромб Васк Биол. 2018; 38:2590–600. https://doi.org/10.1161/ATVBAHA.118.311664 [PubMed]
  • 30. Берг М., Полизос К.А., Агард Х., Баумгартнер Р., Фортеза М.Дж., Карейнен И., Гистеро А., Ботчер Г., Хёрт-Камеджо Э., Ханссон Г.К., Кетельхут Д.Ф. Метаболизм 3-гидроксиантралиновой кислоты контролирует ось SREBP/липопротеины в печени, ингибирует активацию воспаления в макрофагах и уменьшает атеросклероз у мышей Ldlr-/-.Кардиовасц Рез. 2020; 116: 1948–57. https://doi.org/10.1093/cvr/cvz258 [PubMed]
  • 31. Варгезе Дж.Ф., Патель Р., Ядав У.К. Белок, связывающий регуляторный элемент стерола (SREBP)-1, опосредует индуцированное окисленным липопротеином низкой плотности (oxLDL) образование пенистых клеток макрофагов посредством активации воспаления NLRP3. Сотовый сигнал. 2019; 53:316–26. https://doi.org/10.1016/j.cellsig.2018.10.020 [PubMed]
  • 32. Карасава Т., Такахаси А., Сайто Р., Секия М., Игараси М., Ивасаки Х., Мияхара С., Коясу С., Накагава Й., Исии К., Мацудзака Т., Кобаяши К., Яхаги Н. и др. Белок-1, связывающий регуляторный элемент стерола, определяет остаточные липопротеины плазмы и ускоряет развитие атеросклероза у мышей с дефицитом рецепторов липопротеинов низкой плотности. Артериосклеры Тромб Васк Биол. 2011 г.; 31:1788–95. https://doi.org/10.1161/ATVBAHA.110.219659 [PubMed]
  • 33. Шэнь К.П., Хао С.Л., Йен Х.В., Чен С.И., Чен Д.Х., Чен Ф.К., Лин Х.Л. Предварительно проросший коричневый рис предотвращал гиперлипидемию, вызванную диетой с высоким содержанием жиров, за счет улучшения синтеза липидов и метаболизма у мышей C57BL/6J. J Clin Biochem Nutr. 2016; 59:39–44. https://doi.org/10.3164/jcbn.15-117 [PubMed]
  • 34. Варгезе Дж.Ф., Патель Р., Сингх М., Ядав У.К. Физетин предотвращает образование пенистых клеток макрофагов, индуцированных окисленными липопротеинами низкой плотности.J Cardiovasc Pharmacol. 2021; 78:e729–37. https://doi.org/10.1097/FJC.0000000000001096 [PubMed]
  • 35. Ронг Дж. Х., Шапиро М., Троган Э., Фишер Э. А. Трансдифференцировка гладкомышечных клеток аорты мыши в макрофагоподобное состояние после нагрузки холестерином. Proc Natl Acad Sci USA. 2003 г.; 100:13531–6. https://doi.org/10.1073/pnas.1735526100 [PubMed]

Потребление куркумина влияет на сигнатуру микроРНК в мышиной меланоме с наиболее значительным изменением mmu-miR-205-5p

Abstract

Меланома является наиболее агрессивной формой рака кожи, от которой ежегодно во всем мире умирает 48 000 человек.Полифенол куркумин, полученный из растения Curcuma longa , хорошо известен своими противовоспалительными и антиканцерогенными свойствами. Соответственно, прием этого соединения с пищей может быть подходящим для профилактики меланомы. Однако то, как это соединение влияет на основные клеточные механизмы развития меланомы, до сих пор остается неясным. Таким образом, цель этого исследования состояла в том, чтобы впервые изучить влияние перорального введения куркумина на сигнатуру миРНК приживляющейся меланомы.С этой целью влияние диеты с 4% куркумином было проверено на меланому, которая была установлена ​​путем инъекции мышиных клеток B78h2 в бок мышам C57BL/6. Куркуминовую диету или стандартный корм (контроль) вводили за две недели до инъекции опухолевых клеток до окончания эксперимента. Для обнаружения изменений в сигнатуре миРНК опухолей был использован высокопроизводительный матричный анализ на основе чипов. Лечение куркумином значительно уменьшило рост опухолей на боках. Кроме того, сигнатура экспрессии микроРНК в опухолях была существенно изменена при приеме куркумина с экспрессией mmu-miR-205-5p более чем в 100 раз выше по сравнению с контролем.Уровни экспрессии идентифицированных ключевых микроРНК в образцах опухоли были подтверждены количественной полимеразной цепной реакцией в реальном времени (qRT-PCR). Сопоставимый характер экспрессии этих микроРНК был также обнаружен в других клеточных линиях меланомы, обработанных куркумином, в условиях in vitro . Предполагаемые мишени индуцированных куркумином экспрессированных микроРНК были обогащены «биосинтезом о-гликанов», «процессингом белков эндоплазматического ретикулума» и различными путями, связанными с раком. Вестерн-блот-анализ показал, что из этих мишеней антиапоптотический В-клеточный CLL/лимфома 2 (Bcl-2) и ядерный антиген пролиферирующих клеток (PCNA) были значительно подавлены в опухолях, обработанных куркумином.Эти результаты демонстрируют глубокое изменение сигнатуры экспрессии микроРНК при приживлении меланомы, обработанной куркумином, при этом mmu-miR-205-5p активируется наиболее значительно.

Образец цитирования: Дамке И.Н., Бакес С., Рудзитис-Аут Дж., Лашке М.В., Лейдингер П., Менгер М.Д. и соавт. (2013)Прием куркумина влияет на сигнатуру микроРНК при мышиной меланоме с наиболее значительным изменением mmu-miR-205-5p. ПЛОС ОДИН 8(12): е81122. https://doi.org/10.1371/журнал.pone.0081122

Редактор: Soheil S. Dadras, Медицинский центр Университета Коннектикута, Соединенные Штаты Америки

Получено: 28 февраля 2013 г.; Принято: 9 октября 2013 г .; Опубликовано: 12 декабря 2013 г.

Авторское право: © 2013 Dahmke et al. Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

Финансирование: Эта работа была поддержана средствами Немецкого фонда лейкемии Хосе Каррераса (DJCLS R 09/20) для UM. Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

Введение

Малые некодирующие РНК, так называемые микроРНК (миРНК, миР), посттранскрипционно ослабляют многие клеточные процессы [1], [2].Эти эволюционно консервативные микроРНК имеют длину около 22 нуклеотидов и снижают экспрессию белка в пролиферирующих клетках путем связывания с соответствующими мРНК, что приводит либо к подавлению транскрипции, либо к деградации мРНК. Нарушение регуляции профиля микроРНК обнаруживается при многих заболеваниях, в том числе при раке [3]. Например, микроРНК с антипролиферативными и антиангиогенными свойствами, такие как hsa-miR-15, hsa-miR-16 или hsa-miR-221/-222, нацеленные на сосудистый эндотелиальный фактор (VEGF), анти-В-клеточный CLL/ лимфома 2 (Bcl-2) и c-kit рецептора стволовых клеток, соответственно, играют важную роль либо в предотвращении, либо в инициировании канцерогенеза [4], [5], [6].Поскольку было показано, что большинство мРНК млекопитающих являются мишенями miRNAs, изменения экспрессии, связанные с заболеванием, отражают изменения профилей miRNA [7], [8]. Поскольку микроРНК можно выделять из образцов крови, было предложено использовать их в качестве биомаркеров распространенных заболеваний, включая сердечно-сосудистые заболевания и рак [9], [10]. Более того, профили экспрессии микроРНК также могут быть пригодны в качестве маркеров для оценки безопасности и эффективности противораковых средств или для прогнозирования ответа на терапию [11], [12], [13].

Меланома — высокометастатический рак кожи, происходящий из злокачественных меланоцитов. Поскольку лечение злокачественной меланомы остается сложной задачей, первостепенное значение имеет устранение факторов риска. При этом наиболее важным является предотвращение длительного пребывания на солнце и солнечных ожогов, которое может поддерживаться дополнительной диетической химиопрофилактикой с использованием флавоноидов зеленого чая, проантоцианидов и витамина Е [14]. Кроме того, полифенол куркумин (диферулоилметан), полученный из корневища Curcuma longa , был подробно описан в связи с его химиопрофилактическими эффектами за счет подавления клеточных путей, участвующих в биосинтезе белков, митохондриальной активности и нейтрализации свободных радикалов [15], [16]. ].Было показано, что пероральное введение куркумина уменьшает воспаление кожи, способствует заживлению кожи и даже подавляет развитие химически индуцированного рака кожи на различных животных моделях [17], [18], [19]. Кроме того, клинические испытания фазы I и фазы II продемонстрировали многообещающие эффекты перорального введения куркумина у пациентов с колоректальной неоплазией, прогрессирующим раком поджелудочной железы и молочной железы как с дополнительной химиотерапией, так и без нее [20], [21], [22], [23].

Недавно было показано, что куркумин влияет на микроРНК различных опухолевых образований, включая клетки рака поджелудочной железы, молочной железы и легких [24], [25], [26].Например, после стимуляции куркумином в клетках колоректального рака было обнаружено подавление онкомира hsa-miR-21 [27]. Кроме того, miRNAs из семейств hsa-let-7 и hsa-mir-200 повышались, а hsa-miR-21 подавлялись синтетическим производным куркумина [28], [29].

В настоящем исследовании мы исследовали влияние перорального приема куркумина на рост меланомы с целью выявления потенциальных изменений сигнатуры миРНК опухоли. Мы демонстрируем ингибирующий рост эффект диетического куркумина и глубокие изменения в экспрессии микроРНК, при этом mmu-miR-205-5p активируется наиболее значительно.

Материалы и методы

Куркумин

Комплекс

C3, называемый в этой статье куркумином, состоящий из 77% куркумина, 17% деметоксикуркумина и 3% бис-деметоксикуркумина, был приобретен в виде порошка у Sabinsa Corporation.

Заявление об этике

Все процедуры по уходу за животными и экспериментальные процедуры были одобрены местным правительственным комитетом по уходу за животными ( Landesamt für Verbraucherschutz , Abteilung C Lebensmittel- und Veterinärwesen , Саарбрюккен, Германия; номер разрешения: 07/2010) и проводились в соответствии с Европейское законодательство о защите животных (Guideline 2010/63/EU) и Руководство NIH по уходу и использованию лабораторных животных (http://oacu.od.nih.gov/regs/index.htm. 8-е издание; 2011). Все эксперименты проводились под изофлурановой анестезией, и были предприняты все усилия, чтобы свести к минимуму страдания животных.

Животные и куркуминовая диета

Для исследования использовали

самца мышей линии C57BL/6 с массой тела (м.т.) 20–22 г, которые содержали в группах по 3–4 животных. Животных содержали в 12-часовой темной/светлой среде с регулируемой температурой и влажностью в помещении для ухода за животными Института клинической и экспериментальной хирургии Саарского университета.Им был разрешен свободный доступ к водопроводной воде и корму для животных (ssniff Spezialdiäten GmbH). Рацион состоял либо из стандартного корма для мышей (контрольная группа), либо из корма, обогащенного 4% куркумина (группа лечения), приготовленного из той же партии. Это соответствует потреблению куркумина 8 г/кг массы тела. или 160 мг в сутки. Диетическое вмешательство началось за 14 дней до индукции опухоли и продолжалось до конца экспериментов in vivo .

Боковая модель

Для непрерывных измерений размера опухоли в течение 28 дней 1×10 5 клеток B78h2 вводили подкожно в каждый бок самцов мышей C57BL/6 (куркуминовая диета: n = 7, контроль: n = 6).Клетки B78h2 представляют собой клетки амеланотической меланомы мышей, представляющие собой Tap-2 и MHC-I-негативные клоны, полученные из клеток B16 в лаборатории S. Silagi [30]. Клетки B78h2 были любезным подарком Лаборатории иммунологии и биологии метастазирования Отделения экспериментальной патологии Болонского университета [31]. Один раз в неделю объемы опухоли оценивали с помощью системы ультразвуковой визуализации высокого разрешения Vevo 770 (VisualSonics, Inc.). Для этого мышей анестезировали 4% изофлураном (Baxter) и фиксировали в положении лежа на спине на нагретом столике.Анестезия поддерживалась при 2% изофлуране, а гель для ультразвуковой связи (Aquasonic 100; Parker Laboratories Inc.) обильно наносился на фланги перед получением изображений. Стол приводился в движение моторизованным механизмом, так что микровизуализация в реальном времени (RMV) сканирующей головкой 707B (Visual Sonics; 30 МГц) проводилась линейно по коже животных. Чтобы получить параллельные двумерные (2D) изображения, запись производилась через регулярные пространственные интервалы, равномерно расположенные на расстоянии 100 мкм над видимой опухолью и ее ближайшими окрестностями, с полем зрения 17×17 мм 2 .Предварительно заданная параллельная геометрия 2D-изображений позволяла реконструировать 3D-изображения и последующее определение объемов опухоли. После умерщвления животных передозировкой пентобарбитала опухоли извлекали и разделяли на образцы для выделения и анализа микроРНК, количественной полимеразной цепной реакции в реальном времени (qRT-PCR), вестерн-блоттинга и иммуногистохимии.

Выделение и анализ микроРНК

Общая РНК была выделена после фенол-гуанидинового лизиса 50 мкг образцов из боковых опухолей путем очистки на основе силикамембраны с помощью набора miRNeasy Mini Kit (Qiagen) в соответствии с инструкциями производителя.Выделенную РНК анализировали на чипах мышиных микрочипов Sure Print G3 miRNA V17.0 (8x60K; # G4859B) от Agilent Technologies на основе miRBase, версия 17.0, представляющих 1079 мышиных микроРНК с 40 повторами [32]. Вкратце, гибридизацию меченных Cyanine3 образцов миРНК с массивами высокого разрешения проводили при 55°C в течение 20 ч при постоянном вращении (20 об/мин). Чипы-матрицы сканировали в сканере микрочипов высокого разрешения от Agilent Technologies с использованием программного обеспечения Scan Control 8.5.1, разрешение 3 микрона в режиме двойного пути.Значения интенсивности сигнала были извлечены из файла необработанных данных с использованием программного обеспечения для выделения признаков (Agilent Technologies). Мы использовали вычисленное значение gTotalProbeSignal , которое представляет собой среднее значение всех сигналов с поправкой на фон для каждого повторного зонда. Затем мы суммировали gTotalProbeSignals для расчета общего значения экспрессии для каждой микроРНК на образец. Квантильная нормализация применялась для нормализации значений выражений в массивах с использованием пакета preprocessCore языка программирования R .Мы выполнили log2-преобразование данных, которые затем были помещены в Омнибус Gene Expression Omnibus NCBI и доступны через номер доступа GEO Series GSE47211 (http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi? согл= GSE47211) [33]. Для кластерного анализа мы применили иерархическую кластеризацию с полным сцеплением, используя евклидово расстояние, чтобы вычислить несходство микроРНК (строки) и образцов (столбцы) независимо друг от друга. Чтобы сравнить значения экспрессии миРНК между контрольной и лечебной группами, мы применили независимый двусторонний тест t , чтобы найти значительно разрегулированные миРНК.Вычисленные значения P были скорректированы для многократного тестирования с использованием подхода FDR (коэффициент ложных открытий) Бенджамини и Хохберга [34]. МиРНК со значением P с поправкой на FDR менее 0,05 считались статистически значимыми.

Анализ путей микроРНК

Для in silico предсказанные мишени миРНК мыши были загружены из miRDB (http://mirdb.org/miRDB/). Пути, предположительно регулируемые микроРНК, которые изменяются при потреблении куркумина, были обнаружены с помощью анализа сверхпредставления (ORA).Это было выполнено с помощью онлайн-инструмента анализа GeneTrail [35]. В качестве тестовых наборов мы использовали мишени микроРНК с повышенной и пониженной экспрессией, которые обнаруживали дифференциальную экспрессию при сравнении экспериментальной и контрольной группы. В качестве эталонного набора мы использовали мишени всех микроРНК мыши на микрочипе. GeneTrail продемонстрировал поиск в клеточных путях, связанных с заболеванием, в Киотской энциклопедии генов и геномов (KEGG) для обогащения предполагаемых мишеней микроРНК [36]. Значения P для путей KEGG были скорректированы по FDR и считались значимыми, если они были меньше 0.05.

qRT-PCR образцов опухоли

Для проверки результатов микрочипов микроРНК была проведена qRT-PCR для анализа экспрессии четырех выбранных микроРНК mmu-miR-205-5p, mmu-miR-205-3p, mmu-miR-142-5p и mmu- miR-130b-3p с использованием системы ПЦР miScript (Qiagen). Для этого РНК образцов опухолей обратно транскрибировали в кДНК с помощью набора miScript II RT (Qiagen). Образцы анализировали с помощью системы RT-PCR StepOnePlus™ (Applied Biosystems) с анализом праймеров miScript (Qiagen) в соответствии с инструкциями производителя.RNU6B использовали в качестве эндогенного контроля.

Вестерн-блот анализ

Для исследования экспрессии предполагаемых мишеней mmu-miR-205-5p, которая, как было установлено, является наиболее экспрессируемой микроРНК при обработке куркумином, целые белковые фракции очищали от органической фазы РНК на основе фенола/гуанидина. — выделение четырех случайно выбранных опухолей, обработанных куркумином, и четырех контрольных опухолей. Затем наносили 7,5 мкг белка на дорожку, периодически разделяли на полиакриламидные гели с 12% додецилсульфатом натрия и переносили на нитроцеллюлозные мембраны (BioRad).После блокирования сайтов неспецифического связывания мембраны инкубировали в течение ночи при 4°C с мышиным моноклональным антителом против Bcl-2 (1∶1,000; Cell Signaling), мышиным моноклональным антителом к ​​ядерному антигену пролиферирующих клеток (PCNA) ( 1∶1,000; DAKO) и кроличье поликлональное антитело против E2F1 (1∶200; Санта-Крус), а затем соответствующие вторичные антитела, конъюгированные с пероксидазой хрена (HRP) (1∶5,000; Dianova). Экспрессию белка визуализировали с использованием усиленной люминолом хемилюминесценции (ECL Plus; GE Healthcare) и авторадиографической пленки (Hyperfilm; GE Healthcare), как указано производителем.Сигналы оценивали денситометрически с помощью инструмента анализа геля программного обеспечения ImageJ .

Иммуногистохимия

фиксированных формалином образцов обработанных куркумином и контрольных опухолей заливали в парафин. Для анализа плотности микрососудов опухолей с помощью иммуногистохимического обнаружения маркера эндотелиальных клеток CD31 были вырезаны срезы толщиной 2 мкм и окрашены моноклональным крысиным антимышиным антителом против CD31 (1∶30; Dianova) в качестве первичного антитела, а затем цианин- 3-связанный козий антикрысиный IgG (1∶50; Дианова) в качестве вторичного антитела.Контрастное окрашивание ядер клеток проводили с помощью Hoechst (1∶500; Sigma-Aldrich). Затем срезы исследовали с использованием микроскопа BZ-8000 (Keyence) для количественного анализа плотности микрососудов в опухолях, выраженной в мм -2 .

qRT-PCR клеточных линий меланомы

Чтобы выяснить, можно ли индуцированный куркумином характер экспрессии ключевых микроРНК, идентифицированных в экспериментах in vivo , также перенести на другие клеточные линии меланомы, мышиные клетки B78h2, а также человеческие SK-MEL-28 (ATCC® HTB-72™ ) и клетки MeWo (ATCC® HTB-65™) обрабатывали 20 мкМ куркумина или носителя (0.1% ДМСО; контроль) при 37°C и 5% CO 2 в течение 48 часов. Затем клетки собирали и экспрессировали mmu-miR-205-5p, mmu-miR-205-3p (или hsa-miR-205-3p для клеток человека), mmu-miR-142-5p и mmu-miR-142-5p. -130b-3p анализировали с помощью qRT-PCR, как описано выше.

Проточный цитометрический анализ клеток B78h2

Для изучения влияния обработки куркумином на пролиферацию и апоптоз несинхронизированных клеток B78h2 был проведен анализ клеточного цикла с помощью проточной цитометрии.Для этого клетки B78h2 обрабатывали 20 мкМ и 40 мкМ куркумина или растворителем (0,1% ДМСО; контроль) при 37°C и 5% CO 2 в течение 48 часов. Затем клетки фиксировали в метаноле и оставляли на ночь при -20°С. После оттаивания и промывания клетки обрабатывали РНКазой А (1∶400, 10 мг/мл исходного раствора; Macherey-Nagel), окрашивали йодидом пропидия (1∶100, 1 мг/мл исходного раствора; Sigma-Aldrich). и анализировали с помощью FACScan™ (BD Biosystems). Было проведено четыре независимых эксперимента, и каждый образец был проанализирован в двух повторностях.

Статистический анализ

Значения представлены как среднее ± стандартная ошибка среднего (SEM), как кратность экспрессии по сравнению с контролем (qRT-PCR) или как относительная экспрессия (анализ Вестерн-блот). Сначала данные были проанализированы на нормальное распределение и равную дисперсию. Различия между двумя экспериментальными группами рассчитывали по непарному критерию Стьюдента t . Для проверки временных эффектов во время эксперимента в каждой экспериментальной группе применялся дисперсионный анализ (ANOVA) для повторных измерений.Апостериорные анализы включали коррекцию α-ошибки в соответствии с вероятностями Бонферрони для компенсации множественных сравнений (SigmaStat; Jandel Corporation). Значение P <0,05 считалось статистически значимым.

Результаты

Анализ роста опухоли и васкуляризации

Мы проанализировали рост амеланотических опухолей B78h2 на боках мышей C57BL/6, получавших и не получавших куркумин, с помощью ультразвуковой визуализации высокого разрешения.С этой целью мы подкожно инъецировали 1×10 клеток 5 B78h2 в оба бока самцов мышей C57BL/6 для измерения роста опухоли в течение 28 дней и для получения образцов опухоли для профилирования микроРНК. Повторное ультразвуковое исследование развивающихся опухолей на боках выявило заметное уменьшение объема опухоли у животных, получавших куркумин, на 28-й день по сравнению с контрольной группой, не получавшей лечения (рис. 1). Однако дополнительные иммуногистохимические анализы показали, что плотность CD31-позитивных микрососудов в опухолях, обработанных куркумином (64±9 мм -2 ), существенно не отличалась от таковой в контроле (82±8 мм -2 ; P ). = 0.142).

Рисунок 1. Значительное торможение роста меланомы B78h2 куркуминовой диетой.

A, B: репрезентативные изображения опухолей контрольного (A) и животного, получавшего куркумин (B), на 28-й день. Шкала: 2,7 мм. C, D: Ультразвуковые изображения с высоким разрешением опухолей B78h2 либо контрольной (C), либо мыши, получавшей куркумин (D), на 28-й день. Шкала баров: 2,0 мм. E: Объем (мм 3 ) контрольных опухолей (белые кружки) и опухолей, обработанных куркумином (черные кружки), по оценке с помощью повторяющихся ультразвуковых изображений с высоким разрешением.Среднее значение ± стандартная ошибка среднего. a P <0,05 по сравнению с d0, d7 и d14 в отдельной группе; b P <0,05 по сравнению с d0, d7, d14 и d21 в индивидуальной группе; * P  = 0,008 по сравнению с контрольными опухолями.

https://doi.org/10.1371/journal.pone.0081122.g001

Анализ экспрессии микроРНК

На 28-й день общую РНК, включая миРНК, экстрагировали из боковых опухолей контрольных животных, получавших и не получавших куркумин. После выделения тотальной РНК из боковых опухолей мы проанализировали экспрессию 1079 мышиных миРНК на мышиной миРНК Sure Print G3 V17.0 от Agilent Technologies. Мы применили независимый двусторонний тест t для поиска микроРНК, которые были значительно изменены при приеме куркумина. Мы идентифицировали 147 микроРНК, которые значительно по-разному регулируются введением куркумина со скорректированным значением P ниже 0,05. Из 86 микроРНК с повышенной экспрессией мы обнаружили, что 49 микроРНК имеют более чем двукратную активацию, а из 61 микроРНК с пониженной экспрессией мы обнаружили 34 микроРНК со сниженной регуляцией более чем в 0,5 раза (таблица S1).В десятку микроРНК с самой высокой экспрессией вошли mmu-miR-205-5p, mmu-miR-222-3p, mmu-miR-205-3p, mmu-miR-146b-5p, mmu-miR-21-5p, mmu-miR-21-5p, mmu-miR-205-3p, mmu-miR-205-3p, miR-21-3p, mmu-miR-221-3p, mmu-miR-140-3p, mmu-miR-142-5p и mmu-miR-140-5p, а также десять микроРНК с наиболее низким уровнем экспрессии включали mmu-miR -211-5п, мму-миР-3096-5п, мму-миР-711, мму-миР-466х-5п, мму-миР-130б-3п, мму-миР-3082-5п, мму-миР-1199-5п , mmu-miR-669b-5p, mmu-miR-1187 и mmu-miR-1224-5p (табл. 1). Уровни экспрессии mmu-miR-205-5p, mmu-miR-205-3p, mmu-miR-142-5p и mmu-miR-130b-3p, которые ранее были описаны в литературе как микроРНК с потенциальными анти- раковые свойства [37], [38] были подтверждены с помощью qRT-PCR (рис. 2).Интересно, что мы также обнаружили эти ключевые микроРНК, регулируемые куркумином, в культивируемых мышиных клетках B78h2 и клетках человека SK-MEL-28 (рис. 3). Напротив, клетки MeWo, которые происходят из метастазов меланомы в лимфатические узлы, не проявляют сильной регуляции этих микроРНК (рис. 3).

Рисунок 2. Подтверждение экспрессии ключевой миРНК методом qRT-PCR при меланоме B78h2, регулируемой диетой с куркумином.

На диаграммах представлены гистограммы экспрессии сгиба (по сравнению с контролем) mmu-miR-205-5p, mmu-miR-205-3p, mmu-miR-142-5p и mmu-miR-130b-3p в куркумине -леченная меланома B78h2, по оценке массива миРНК (серые столбцы) и qRT-PCR (черные столбцы).Пунктирная линия указывает уровень экспрессии контроля.

https://doi.org/10.1371/journal.pone.0081122.g002

Рисунок 3. Экспрессия ключевых микроРНК в различных клеточных линиях меланомы, обработанных куркумином.

На диаграмме представлены гистограммы кратности экспрессии (по сравнению с контрольными клетками, обработанными носителем) mmu-miR-205-5p, mmu-miR-205-3p, mmu-miR-142-5p и mmu-miR-130b -3p обработанных куркумином клеток B78h2 мыши (белые столбцы), человеческого SK-MEL-28 (серые столбцы) и клеток меланомы человека MeWo (черные столбцы), по оценке с помощью qRT-PCR.Культивируемые клетки обрабатывали 20 мкМ куркумина или растворителем (0,1% ДМСО) в течение 48 часов. Пунктирная линия указывает уровень экспрессии контроля.

https://doi.org/10.1371/journal.pone.0081122.g003

Медиана логарифмической экспрессии десяти микроРНК с наибольшей дерегуляцией представлена ​​на рисунке 4. Наиболее активная микроРНК, mmu-mir-205-5p, был в 135 раз выше, а экспрессия микроРНК с наиболее низким уровнем экспрессии, mmu-mir-211-5p, была в 35,7 раз ниже в образцах, обработанных куркумином (таблица 1).Эти данные показывают, что потребление куркумина оказывает глубокое влияние на сигнатуру экспрессии миРНК в опухолях. Чтобы дополнительно оценить эффект куркумина, мы выполнили полную иерархическую кластеризацию сцепления с использованием 50 микроРНК, которые показали самую высокую дисперсию экспрессии во всех образцах. Как показано на рисунке 5, мы обнаружили два основных кластера профилей экспрессии микроРНК для 7 образцов куркумина и 6 контрольных образцов. Очевидная кластеризация между двумя группами дает дополнительные доказательства влияния куркуминовой диеты на профиль экспрессии миРНК в опухолях.

Рисунок 4. Профиль экспрессии микроРНК из первой десятки меланомы B78h2, регулируемой куркуминовой диетой.

На диаграмме показаны гистограммы медианы логарифмической экспрессии первой десятки экспрессируемых (A) и десяти наиболее низкорегулируемых (B) микроРНК меланомы B78h2 после приема куркумина (черные столбцы) по сравнению с контрольной группой. (белые полосы).

https://doi.org/10.1371/journal.pone.0081122.g004

Рисунок 5. Диета с куркумином вызывает кластеризацию биологических реплик за счет изменения сигнатуры микроРНК меланомы B78h2.

Группирование самцов мышей C57BL/6, получавших в течение 6 недель либо диету с куркумином, либо контрольную диету, на основе уровней экспрессии микроРНК при меланоме B78h2. Эта диаграмма основана на 50 микроРНК с наибольшей дисперсией во всех образцах. Изменение экспрессии микроРНК представлено разными цветами (см. цветовой код ). Полная иерархическая кластеризация сцепления была выполнена с использованием евклидова расстояния для расчета несходства микроРНК и образцов независимо друг от друга. Кластеризация образцов иллюстрируется верхней дендрограммой, кластеризация микроРНК — левой дендрограммой.Обратите внимание, что на основе оцененных мышей C57BL / 6 контрольные и куркуминовые животные четко делятся на два основных кластера.

https://doi.org/10.1371/journal.pone.0081122.g005

Используя наш инструмент анализа наборов генов GeneTrail , мы выполнили in silico анализов пути отдельно для предсказанных целей из общего числа 86 ап- регулируемая и всего 61 микроРНК с подавленной регуляцией. Предполагаемые мишени индуцированных куркумином экспрессированных микроРНК были обогащены в путях KEGG «биосинтез о-гликанов», «процессинг белков эндоплазматического ретикулума», а также в нескольких путях, связанных с раком (таблица 2).Также было обнаружено, что предполагаемые мишени экспрессированных микроРНК обогащены инсулиновым путем и, кроме того, связаны с сердечным и неврологическим контекстами (таблица 2). Кроме того, мы обнаружили чрезмерную представленность в Gene Ontology (GO) терминов «клеточная пролиферация», «клеточная гибель» и «регуляция апоптоза». Было обнаружено, что предполагаемые мишени микроРНК со сниженной регуляцией обогащены большим количеством путей KEGG, включая сигнальный путь mTOR- и ErbB, а также несколькими путями, связанными с раком (таблица 2).

Проверка цели

На основании наших анализов in silico мы выбрали антиапоптотический Bcl-2 и фактор транскрипции E2F1 для PCNA, чтобы подтвердить некоторые из предсказанных мишеней mmu-miR-205-5p, которая была микроРНК, наиболее сильно регулируемой куркумином. лечение. Мы обнаружили, что экспрессия Bcl-2 была значительно снижена в опухолях, обработанных куркумином, по сравнению с контролем (рис. 6). Напротив, экспрессия E2F1 не была заметно изменена при лечении куркумином (рис. 6).Однако экспрессия нижестоящего маркера пролиферации PCNA была значительно снижена в опухолях при куркуминовой диете (рис. 6).

Рис. 6. Вестерн-блоттинг экспрессии белков-мишеней mmu-miR-205-5 при меланоме B78h2.

Относительная экспрессия Bcl-2, E2F1 и PCNA в меланоме B78h2 в контроле (белые столбцы, n = 4) и у животных, получавших куркумин (черные столбцы, n = 4), по оценке Вестерн-блоттинга. Среднее значение ± стандартная ошибка среднего. * P <0,05 по сравнению с контролем.

https://doi.org/10.1371/journal.pone.0081122.g006

Анализ клеточного цикла

Анализы клеточного цикла с помощью проточной цитометрии показали дозозависимый более высокий процент апоптотических клеток в клетках B78h2, обработанных куркумином, по сравнению с контрольными клетками, обработанными носителем (рис. 7). Более того, лечение куркумином в зависимости от дозы приводило к задержке S-фазы, что указывает на дополнительное ингибирующее действие на пролиферацию клеток (рис. 7).

Рисунок 7. Анализ клеточного цикла обработанных куркумином клеток B78h2.

Закрытые клетки [%] в фазе G1 (белые столбцы), S-фазе (темно-серые столбцы), фазе G2 (светло-серые столбцы) и апоптозе (черные столбцы), измеренные с помощью проточной цитометрии. Культивируемые клетки обрабатывали 20 мкМ и 40 мкМ куркумина или носителем (0,1% ДМСО) в течение 48 часов. Среднее значение ± стандартная ошибка среднего. * P <0,05 по сравнению с контролем.

https://doi.org/10.1371/journal.pone.0081122.g007

Обсуждение

В настоящем исследовании мы исследовали влияние потребления куркумина с пищей на сигнатуру экспрессии миРНК приживляющихся мышиных меланом, которые были установлены путем инъекции мышиных клеток B78h2 в бок мышей C57BL/6.Поскольку этот подход не включает преобразование нормальных клеток в опухолевые клетки (инициация опухоли), наблюдаемые здесь эффекты куркумина могут иметь значение в первую очередь для терапии или вторичной профилактики, но не для первичной профилактики рака.

Сначала мы проанализировали потенциальные противораковые свойства перорального лечения куркумином, о которых ранее сообщалось в литературе. К ним относятся, в частности, ингибирование клеточной пролиферации и роста опухоли [18], [19], [39].В соответствии с этими выводами мы наблюдали в нашей модели на боку уменьшение размера опухоли у животных, получавших куркумин.

Кроме того, куркумин был описан как антиангиогенный агент [16]. Поэтому мы дополнительно измерили плотность микрососудов обработанных куркумином и контрольных опухолей путем иммуногистохимического обнаружения маркера эндотелиальных клеток CD31. Мы обнаружили, что плотность CD31-позитивных микрососудов в опухолях, обработанных куркумином, существенно не отличалась от контрольной группы.Однако это не обязательно указывает на то, что куркумин не оказывает антиангиогенного действия на обработанные опухоли. Фактически, согласно Hlatky et al. [40] и Нико и соавт. [41], опухоли при антиангиогенном лечении могут следовать адаптации «уменьшаться до размеров». Это означает, что популяция опухолевых клеток может уменьшаться прямо пропорционально потере поддерживающей ее сосудистой сети, что приводит к постоянному соотношению между опухолевыми клетками и микрососудами и, таким образом, к постоянной плотности микрососудов. Соответственно, здесь мы обнаружили, что пролиферация опухолевых клеток была заметно снижена у животных, получавших куркумин, по сравнению с контрольной группой.

На следующем этапе мы проанализировали сигнатуру миРНК изолированных опухолей на боку, потому что появляется все больше доказательств того, что миРНК играют ключевую роль в этиологии рака. miRNAs могут действовать как супрессоры опухолей, но также и как онкогены ( onco-mir ). Здесь мы приводим убедительные доказательства того, что общий паттерн экспрессии микроРНК в меланомах мышей, получавших куркумин, заметно изменился. В первую десятку микроРНК, уровень экспрессии которых значительно повышался при лечении куркумином, вошли mmu-miR-205-5p (в 135 раз), mmu-miR-205-3p (в 9 раз) и mmu-miR-142-5p (в 6 раз). ).Уровни их экспрессии были подтверждены с помощью qRT-PCR. Было показано, что повышающая регуляция mmu-miR-205-5p и -3p обращает эпителиально-мезенхимальный переход в различных опухолях с E-кадгерином в качестве центральной мишени [42], [43]. Было обнаружено, что Hsa-miR-205 подавляется в 100 раз при метастатической меланоме человека по сравнению с неметастатической меланомой [38]. Снижение экспрессии miR-142-5p связано с рецидивами и плохой общей выживаемостью у пациентов с раком желудка и поджелудочной железы [12], [44]. Кроме того, мы также идентифицировали несколько miRNAs, которые были значительно снижены в меланомах, обработанных куркумином, таких как mmu-miR-130b-3p.В предыдущих исследованиях было обнаружено, что эта микроРНК активируется при злокачественной меланоме кожи [37]. Ли и др. [45] смогли продемонстрировать, что hsa-miR-130b индуцирует эпителиально-мезенхимальный переход при раке эндометрия. В совокупности эти результаты показывают, что регулируемые куркумином миРНК mmu-miR-205-5p, mmu-miR-205-3p, mmu-miR-142-5p и mmu-miR-130b-3p представляют собой многообещающие мишени, а также маркеры. для определения агрессивности и метастатической активности злокачественных опухолей.

В дополнительных экспериментальных условиях мы проанализировали, лежат ли эти ключевые микроРНК в основе сходной регуляции в разных клеточных линиях меланомы.Для этой цели мы определили их экспрессию с помощью qRT-PCR в обработанных куркумином и обработанных носителем мышиных клетках B78h2, а также человеческих клетках SK-MEL-28 и MeWo. Обработка куркумином приводила к более высоким уровням экспрессии в культивируемых клетках B78h2 и SK-MEL-28 по сравнению с контролем. Напротив, клетки MeWo не обнаруживают сильной регуляции ключевых микроРНК. Это может быть связано с тем, что клетки MeWo происходят из метастазов меланомы в лимфатические узлы. Таким образом, они могут демонстрировать совершенно другой профиль экспрессии микроРНК по сравнению с клетками, происходящими из первичных опухолей.

Интересно, что некоторые из наиболее сильно измененных микроРНК не регулировались так, как ожидалось, исходя из результатов других исследований. Например, было показано, что подавление hsa-miR-211-5p связано с прогрессированием меланомы [38], [46], а не с ингибированием роста опухоли при лечении куркумином меланомы, как это наблюдалось в настоящем исследовании. Эти противоречивые результаты могут быть объяснены тем фактом, что измененная экспрессия микроРНК не обязательно подразумевает прямое влияние куркумина на экспрессию микроРНК в опухоли, но также может быть основана на регуляции косвенной обратной связи.Кроме того, эффекты лечения куркумином могут различаться между опухолями различной клеточной этиологии или, кроме того, в зависимости от различных экспериментальных установок. Например, несколько исследователей показали снижение активности hsa-mir-21 после лечения куркумином в клетках рака поджелудочной железы, пищевода и предстательной железы человека [28], [29], [47], [48]. Напротив, Sun et al. [24] обнаружили повышенную регуляцию экспрессии hsa-miR-21, вызванную обработкой куркумином в клетках поджелудочной железы, сходную с нашими выводами.

Наш анализ чрезмерной репрезентативности (ORA) идентифицировал несколько предполагаемых клеточных путей, которые модулируются повышающей и понижающей регуляцией miRNAs.Было обнаружено, что предполагаемые мишени miRNAs обогащены метаболическими путями, такими как путь инсулина, а также в сердечно-ассоциированном и неврологическом контекстах, что указывает на потенциальную роль куркумина в управлении метаболическим синдромом. Кроме того, многие из путей, обнаруженных ORA, были связаны с пролиферацией клеток и апоптотической гибелью клеток при раке, что подчеркивает влияние куркумина на лечение злокачественных новообразований.

На основании современной литературы и нашего анализа in silico предполагаемые мишени mmu-miR-205-5p включают E2F1, E2F3, E2F5, Bcl-2, CD31, фактор транскрипции, индуцируемый гипоксией (HIF)-1α, и VEGF. [49], [50].Из этих мишеней мы выбрали антиапоптотические Bcl-2 и E2F1, который является фактором транскрипции для PCNA, для дальнейшей проверки с помощью вестерн-блоттинга. Интересно, что мы обнаружили, что экспрессия Bcl-2 была значительно снижена в опухолях, обработанных куркумином, по сравнению с контролем, тогда как экспрессия E2F1 заметно не изменилась. Однако экспрессия PCNA была значительно снижена при куркуминовой диете. Это указывает на то, что экспрессия этого маркера пролиферации может регулироваться другими миРНК, чем mmu-miR-205-5p, или другими факторами транскрипции, кроме E2F1.В этом контексте mmu-miR-222 представляет собой потенциального кандидата, который, как также было обнаружено, активируется в настоящем исследовании и непосредственно регулирует экспрессию PCNA. Наши результаты по снижению экспрессии Bcl-2 и PCNA были дополнительно подтверждены анализом клеточного цикла проточной цитометрией клеток B78h2, обработанных куркумином, что указывает на то, что куркумин влияет как на апоптоз, так и на пролиферацию этой клеточной линии меланомы.

В заключение, мы впервые демонстрируем явное влияние диетического куркумина на профиль миРНК в мышиной меланоме, при этом mmu-miR-205-5p активируется наиболее широко.Иерархическая кластеризация связей 50 микроРНК с самой высокой вариабельностью экспрессии выявила группировку в два основных кластера, один из которых включает обработанных животных, а другой — контролей. Предполагаемые мишени индуцированных куркумином экспрессируемых miRNAs обогащены несколькими путями, связанными с раком. Эти данные свидетельствуют о том, что микроРНК играют значительную роль в ингибировании роста меланомы при пероральном введении куркумина.

Благодарности

Мы высоко ценим техническую помощь Джанин Беккер.Мы благодарим профессора Клауса Ремера за любезно предоставленное антитело E2F1.

Авторские взносы

Задумал и спроектировал эксперименты: IND MWL MDM EM UM. Выполненные эксперименты: IND CB JR PL. Проанализированы данные: IND CB PL. Предоставленные реагенты/материалы/инструменты для анализа: MWL MDM EM UM. Написал статью: IND CB MWL PL MDM EM UM.

Каталожные номера

  1. 1. Фабиан М.Р., Соненберг Н., Филипович В. (2010)Регулирование трансляции и стабильности мРНК с помощью микроРНК.Annu Rev Biochem 79: 351–379.
  2. 2. Читвуд Д.Х., Тиммерманс М.К. (2010) Малые РНК находятся в движении. Природа 467: 415–419.
  3. 3. Таби Р., Исса Дж. П. (2010) Эпигенетика рака. CA Cancer J Clin 60: 376–392.
  4. 4. Чиммино А., Калин Г.А., Фаббри М., Иорио М.В., Феррацин М. и соавт. (2005) миР-15 и миР-16 индуцируют апоптоз путем нацеливания на BCL2. Proc Natl Acad Sci USA 102: 13944–13949.
  5. 5. Litz J, Krystal GW (2006)Иматиниб ингибирует индуцированную c-Kit активность фактора-1альфа, индуцируемого гипоксией, и экспрессию фактора роста эндотелия сосудов в клетках мелкоклеточного рака легкого.Мол Рак Тер 5: 1415–1422.
  6. 6. Suarez Y, Fernandez-Hernando C, Pober JS, Sessa WC (2007)Dicer-зависимые микроРНК регулируют экспрессию генов и функции в эндотелиальных клетках человека. Цирк рез. 100: 1164–1173.
  7. 7. Фридман Дж.М., Джонс П.А. (2009)МикроРНК: критические медиаторы дифференцировки, развития и заболевания. Swiss Med Wkly 139: 466–472.
  8. 8. Полисено Л., Хаймович А., Сегура М.Ф., Ханнифорд Д., Христос П.Дж. и др. (2012)Гистологически специфичные изменения микроРНК при меланоме.J Invest Dermatol 132: 1860–1868.
  9. 9. Fichtlscherer S, Zeiher AM, Dimmeler S (2011)Циркулирующие микроРНК: биомаркеры или медиаторы сердечно-сосудистых заболеваний? Arterioscler Thromb Vasc Biol 31: 2383–2390.
  10. 10. Келлер А., Лейдингер П., Гислефосс Р., Хауген А., Лангсет Х. и др. (2011)Стабильные профили микроРНК в сыворотке как потенциальный инструмент для неинвазивной диагностики рака легких. РНК Биол 8: 506–516.
  11. 11. Izzotti A, Cartiglia C, Steele VE, De Flora S (2012)МикроРНК как мишени для диетических и фармакологических ингибиторов мутагенеза и канцерогенеза.Мутат Рез 751: 287–303.
  12. 12. Охучида К., Мидзумото К., Каяшима Т., Фудзита Х., Морияма Т. и др. (2011)Экспрессия микроРНК как прогностический маркер ответа на гемцитабин после хирургической резекции рака поджелудочной железы. Энн Сург Онкол 18: 2381–2387.
  13. 13. Иззотти А., Ларгеро П., Картилья С., Лонгобарди М., Пфеффер У. и др. (2010) Модуляция экспрессии микроРНК будесонидом, фенетилизотиоцианатом и сигаретным дымом в печени и легких мышей. Канцерогенез 31: 894–901.
  14. 14. Jensen JD, Wing GJ, Dellavalle RP (2010)Питание и профилактика меланомы. Клин Дерматол 28: 644–649.
  15. 15. Сингх М., Сингх Н. (2009)Молекулярный механизм индуцированной куркумином цитотоксичности в клетках карциномы шейки матки человека. Mol Cell Biochem 325: 107–119.
  16. 16. Kunnumakkara AB, Anand P, Aggarwal BB (2008)Куркумин ингибирует пролиферацию, инвазию, ангиогенез и метастазирование различных видов рака посредством взаимодействия с несколькими клеточными сигнальными белками.Рак Летт 269: 199–225.
  17. 17. Okunieff P, Xu J, Hu D, Liu W, Zhang L, et al. (2006) Куркумин защищает от радиационно-индуцированной острой и хронической кожной токсичности у мышей и снижает экспрессию мРНК воспалительных и фиброгенных цитокинов. Int J Radiat Oncol Biol Phys 65: 890–898.
  18. 18. Филлипс Дж. М., Кларк С., Херман-Фердинандез Л., Мур-Медин Т., Ронг Х. и др. (2011) Куркумин ингибирует рост опухоли плоскоклеточного рака кожи in vivo. Отоларингол Head Neck Surg 145: 58–63.
  19. 19. Лимтракул П., Липигорнгосон С., Намвонг О., Аписариякул А., Данн Ф.В. (1997)Ингибирующее действие диетического куркумина на канцерогенез кожи у мышей. Рак Летт 116: 197–203.
  20. 20. Кэрролл Р.Э., Бенья Р.В., Турген Д.К., Варид С., Нойман М. и др. (2011) Фаза IIa клинических испытаний куркумина для профилактики колоректальной неоплазии. Рак Prev Res (Phila) 4: 354–364.
  21. 21. Канаи М., Йошимура К., Асада М., Имаидзуми А., Судзуки С. и др.(2011)Исследование фазы I/II химиотерапии на основе гемцитабина плюс куркумин у пациентов с резистентным к гемцитабину раком поджелудочной железы. Рак Chemother Pharmacol 68: 157–164.
  22. 22. Диллон Н., Аггарвал Б.Б., Ньюман Р.А., Вольф Р.А., Куннумаккара А.Б. и соавт. (2008)Исследование фазы II куркумина у пациентов с распространенным раком поджелудочной железы. Clin Cancer Res 14: 4491–4499.
  23. 23. Bayet-Robert M, Kwiatkowski F, Leheurteur M, Gachon F, Planchat E, et al. (2010) Испытание фазы I повышения дозы доцетаксела плюс куркумин у пациентов с распространенным и метастатическим раком молочной железы.Рак Биол Тер 9: 8–14.
  24. 24. Sun M, Estrov Z, Ji Y, Coombes KR, Harris DH, et al. (2008)Куркумин (диферулоилметан) изменяет профили экспрессии микроРНК в клетках рака поджелудочной железы человека. Мол Рак Тер 7: 464–473.
  25. 25. Yang J, Cao Y, Sun J, Zhang Y (2010)Куркумин снижает экспрессию Bcl-2 путем усиления миР-15a и миР-16 в клетках MCF-7. Мед Онкол 27: 1114–1118.
  26. 26. Zhang J, Du Y, Wu C, Ren X, Ti X и др.(2010)Куркумин способствует апоптозу в клетках аденокарциномы легких человека через сигнальный путь миР-186*. Онкол Реп 24: 1217–1223.
  27. 27. Муддулуру Г., Джордж-Уильям Дж. Н., Муппала С., Асангани И. А., Кумарсвами Р. и др. (2011) Куркумин регулирует экспрессию миР-21 и ингибирует инвазию и метастазирование при колоректальном раке. Biosci Rep 31: 185–197.
  28. 28. Бао Б., Али С., Банерджи С., Ван З., Логна Ф. и др. (2012)Аналог куркумина CDF ингибирует рост опухоли поджелудочной железы, включая супрессорные микроРНК и ослабляя экспрессию EZh3.Рак Рез. 72: 335–345.
  29. 29. Бао Б., Али С., Конг Д., Саркар С.Х., Ван З. и др. (2011) Противоопухолевая активность нового соединения-CDF опосредована регуляцией миР-21, миР-200 и PTEN при раке поджелудочной железы. PLoS One 6: e17850.
  30. 30. Newcomb EW, Silverstein SC, Silagi S (1978)Злокачественные клетки меланомы мыши не образуют опухолей при смешивании с клетками незлокачественного субклона: взаимосвязь между экспрессией активатора плазминогена опухолевыми клетками и иммунным ответом хозяина.J Cell Physiol 95: 169–177.
  31. 31. Лоллини П.Л., Де Джованни С., Дель Ре Б., Николетти Г., Проди Г. и др. (1987)Опосредованное интерфероном усиление метастазирования. Участвуют ли антигены MHC? Clin Exp Metastasis 5: 277–287.
  32. 32. Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ (2008) miRBase: инструменты для геномики микроРНК. Рез. нуклеиновых кислот 36: D154–158.
  33. 33. Эдгар Р., Домрачев М., Лэш А.Е. (2002) Омнибус экспрессии генов: хранилище данных массива экспрессии генов и гибридизации NCBI.Nucleic Acids Res 2002 30: 207–210.
  34. 34. Benjamini Y, Hochberg Y (1995) Контроль уровня ложных открытий: практичный и мощный подход к множественному тестированию. JR Statist Soc B 57: 289–300.
  35. 35. Backes C, Keller A, Kuentzer J, Kneissl B, Comtesse N, et al. (2007) GeneTrail — расширенный анализ обогащения набора генов. Нуклеиновые кислоты Рез. 35: W186–192.
  36. 36. Танабэ М., Канехиса М. (2012) Использование ресурса базы данных KEGG. Curr Protoc Bioinformatics Chapter 1: Unit1 12.
  37. 37. Санд М., Скрыган М., Санд Д., Георгас Д., Гамбихлер Т. и др. (2013)Сравнительный микрочиповый анализ профилей экспрессии микроРНК при первичной злокачественной меланоме кожи, метастазах злокачественной меланомы кожи и доброкачественных меланоцитарных невусах. Анализ клеточной ткани 351: 85–98.
  38. 38. Xu Y, Brenn T, Brown ER, Doherty V, Melton DW (2012)Дифференциальная экспрессия микроРНК во время прогрессирования меланомы: miR-200c, miR-205 и miR-211 подавляются при меланоме и действуют как супрессоры опухоли.Бр Дж Рак 106: 553–561.
  39. 39. Leyon PV, Kuttan G (2003)Исследования роли некоторых синтетических производных куркуминоидов в ингибировании опухолеспецифического ангиогенеза. J Exp Clin Cancer Res 22: 77–83.
  40. 40. Hlatky L, Hahnfeldt P, Folkman J (2002)Клиническое применение антиангиогенной терапии: плотность микрососудов, что она делает и о чем не говорит. J Natl Cancer Inst 94: 883–893.
  41. 41. Нико Б., Бенаджано В., Мангьери Д., Маруотти Н., Вакка А. и др.(2008)Оценка плотности микрососудов в опухолях: за и против. Histol Histopathol 23: 601–607.
  42. 42. Грегори П.А., Берт А.Г., Патерсон Э.Л., Барри С.К., Цыкин А. и соавт. (2008) Семейство миР-200 и миР-205 регулируют переход от эпителия к мезенхиме путем нацеливания на ZEB1 и SIP1. Nat Cell Biol 10: 593–601.
  43. 43. Грин С.Б., Гунаратне П.Х., Хаммонд С.М., Розен Дж.М. (2010) Предполагаемая роль микроРНК-205 в предшественниках эпителиальных клеток молочной железы. J Cell Sci 123: 606–618.
  44. 44. Zhang X, Yan Z, Zhang J, Gong L, Li W и др. (2011)Комбинация hsa-miR-375 и hsa-miR-142-5p в качестве предиктора риска рецидива у пациентов с раком желудка после хирургической резекции. Энн Онкол 22: 2257–2266.
  45. 45. Li BL, Lu C, Lu W, Yang TT, Qu J и др. (2013) miR-130b представляет собой микроРНК, связанную с EMT, которая нацелена на DICER1 для агрессии при раке эндометрия. Мед Онкол 30: 484.
  46. 46. Мазар Дж., ДеЯнг К., Хайтан Д., Мейстер Э., Альмодовар А. и др.(2010) Регуляция экспрессии микроРНК-211 и ее роль в инвазивности клеток меланомы. PLoS One 5: e13779.
  47. 47. Субраманиам Д., Поннурангам С., Рамамурти П., Стандинг Д., Баттафарано Р.Дж. и др. (2012) Куркумин вызывает гибель клеток в клетках рака пищевода посредством модулирования передачи сигналов Notch. PLoS One 7: e30590.
  48. 48. Али С., Ахмад А., Банерджи С., Падхье С., Доминиак К. и др. (2010) Чувствительность к гемцитабину можно индуцировать в раковых клетках поджелудочной железы посредством модуляции экспрессии миР-200 и миР-21 куркумином или его аналогом CDF.Рак Рез. 70: 3606–3617.
  49. 49. Дар А.А., Маджид С., де Семир Д., Носрати М., Безрукове В. и др. (2011) miRNA-205 подавляет пролиферацию клеток меланомы и индуцирует старение посредством регуляции белка E2F1. J Biol Chem 286: 16606–16614.
  50. 50. Алла В., Коутхарапу Б.С., Энгельманн Д., Эммрих С., Шмитц У. и соавт. (2012) E2F1 придает устойчивость к противоопухолевым препаратам путем нацеливания на членов семейства транспортеров ABC и Bcl-2 через схему p73/DNp73-miR-205. Клеточный цикл 11: 3067–3078.

План здорового питания на 7 дней (8-14 ноября)

опубликовано 5 ноября 2021 г. автором Джина

Этот пост может содержать партнерские ссылки. Прочтите мою политику раскрытия информации.

Бесплатный 7-дневный гибкий план питания для похудения, включающий завтрак, обед и ужин, а также список покупок. Рецепты включают макросы и WW Points.

7-дневный план здорового питания

Будь то День Благодарения или ранняя вечеринка в честь Дня Благодарения, никогда не помешает спланировать заранее! Нужно принести сторону? Попробуйте мои маффины с начинкой.Отвечает за зеленую фасоль? Попробуйте более легкую версию с моей облегченной запеканкой из зеленой фасоли. Заботиться о сладкой стороне? Попробуйте мой соус для тыквенного пирога (подавайте в маленькой тыкве для отличной презентации) или эти забавные шутеры с тыквенным чизкейком.

Почему каждый должен планировать питание?

Планирование питания — отличный способ спланировать питание на неделю вперед. Вы также экономите время и деньги в супермаркете! И, конечно же, планирование наперед поможет вам придерживаться ваших целей! Оцените мой новый планировщик еды Skinnytaste, на который уже можно оформить предварительный заказ!

О плане питания

Если вы новичок в моих планах питания, я делюсь этими бесплатными 7-дневными гибкими планами здорового питания (вы можете увидеть мои предыдущие планы питания здесь), которые предназначены в качестве руководства, с большим пространством для маневра для вас. чтобы добавить больше еды, кофе, напитков, фруктов, закусок, десерта, вина и т. д.или поменять местами рецепты блюд, которые вы предпочитаете, вы можете искать рецепты по курсам в указателе. Вы должны стремиться потреблять около 1500 калорий* в день.

Также есть точный, систематизированный список продуктов, который сделает покупки продуктов намного проще и менее напряженными. Сэкономьте деньги и время. Вы будете реже обедать вне дома, тратить меньше еды, и у вас будет все необходимое под рукой, чтобы не сбиться с пути.

Наконец, если вы зарегистрированы на Facebook, присоединяйтесь к моему сообществу Skinnytaste на Facebook, где все делятся фотографиями рецептов, которые они готовят, вы можете присоединиться здесь.Мне нравятся все идеи, которыми все делятся! Если вы хотите попасть в список рассылки, вы можете подписаться здесь, чтобы никогда не пропустить план питания!

ДЕТАЛИ:

Завтрак и обед с понедельника по пятницу рассчитаны на 1 человека, а ужины и все приемы пищи в субботу и воскресенье рассчитаны на семью из 4 человек. По некоторым рецептам остатков достаточно на два вечера или на обед на следующий день. Хотя мы искренне верим, что не существует единого плана питания, подходящего для всех, мы сделали все возможное, чтобы придумать что-то, что понравится широкому кругу людей.Все подходит для людей, следящих за фигурой, я включил обновленный WW Blue SP для вашего удобства, не стесняйтесь менять любые рецепты, которые вы хотите, или просто используйте это для вдохновения!

Полный список продуктов включает в себя все необходимое для приготовления всех блюд по плану. Я даже включил рекомендации брендов продуктов, которые я люблю и часто использую. Перепроверьте свои шкафы, потому что многие приправы, которые вы заметите, я использую часто, так что у вас их уже может быть много.

И последнее, но не менее важное: этот план питания является гибким и реалистичным.Здесь есть много места для коктейлей, здоровых закусок, десертов и ужинов вне дома. И при необходимости вы можете переместить некоторые вещи, чтобы они соответствовали вашему расписанию. Пожалуйста, дайте мне знать, если вы используете эти планы, это поможет мне решить, следует ли мне продолжать делиться ими!

ПОНЕДЕЛЬНИК (8.11)
B: Киш без корочки * (5B 6G 5P) с апельсином (0B 0G 0P)
L: Бутерброд с салатом Chicken Club (5B 7G 5P) и яблоком (0B 0G 0P)
D: Грибной бефстроганов (9Б 10Г 9П) с зеленым салатом* (1Б 1Г 1П)

Итого: WW Points 20B 24G 20P, Калории 1023**

ВТОРНИК (9.11)
B: Киш без корочки (5B 6G 5P) с грушей (0B 0G 0P)
L: Салат из нута и тунца (0B 8G 0P) на 2 чашки смешанной зелени (0B 0G 0P)
D: Тако с курицей в медленноварке (7B 10G 7P)

Итого: WW Points 12B 24G 12P, Калории 1,085**

СРЕДА (10.11)
B: Киш без корочки (5B 6G 5P) с апельсином (0B 0G 0P)
L: Бутерброд с салатом Chicken Club (5B 7G 5P) и яблоком (0B 0G 0P)
D: говядина брокколи (7B 7G 7P) с ¾ чашки коричневого риса (5B 5G 0P)

Всего: Очки WW 22B 25G 17P, Калории 1126**

ЧЕТВЕРГ (11.11)
B: Тыквенный пирог с овсянкой на ночь (7B 7G 4P)
L: ОСТАЛОСЬ Салат из нута и тунца (0B 8G 0P) на 2 чашки смешанной зелени (0B 0G 0P)
D: Crock Pot Kid- Friendly Turkey Chili (0B 4G 4P) с 2 столовыми ложками сыра чеддер (2B 2G 2P) и 1 унцией авокадо (1B 1G 1P)

Итого: WW Points 10B 22G 11P, Калории 895**

ПЯТНИЦА (12.11)
B: Овсяные хлопья с тыквенным пирогом (7B 7G 4P)
L: LEFTOVER Crock Pot, подходит для детей с чили из индейки (0B 4G 4P) с 2 столовыми ложками сыра чеддер (2B 2G 2P) и 1 унцией авокадо (1B 1G 1P)
D: Пьяная лапша с креветками (9B 11G 9P)

Всего: Очки WW 19B 25G 20P, Калории 1,084**

СУББОТА (13.11)
B: запеканка Tex Mex Breakfast (6B 8G 5P) и апельсин (0B 0G 0P)
L: томатный суп быстрого приготовления с базиликом (5B 5G 5P) с жареным сыром # (7B 7G 7P)
D: ОБЕД

Всего: Очки WW 18B 20G 17P, Калории 725**

ВОСКРЕСЕНЬЕ (14.11)
B: ОСТАВШАЯСЯ запеканка для завтрака Tex Mex (6B 8G 5P) и 1 чашка винограда (0B 0G 0P)
L: Салат с нарезанными кусочками и салатом из курицы по-азиатски (8B 8G 8P)
D: Жареная куркума Курица и сладкий картофель (11B 11G 8P)

Всего: Очки WW 25B 27G 21P, Калории 1200**

*Приготовьте пирог с заварным кремом и беконом для обертывания в воскресенье, если хотите, и заморозьте оставшийся пирог с заварным кремом, который вы/ваша семья не будете есть.
Зеленый салат включает 6 чашек смешанной зелени, 2 зеленого лука, по ½ чашки каждого: помидоры, огурцы, морковь, нут и ¼ чашки легкого винегрета
.

**Это всего лишь ориентир, женщины должны потреблять около 1500 калорий в день. Вот полезный калькулятор для оценки ваших потребностей в калориях. Я оставил вам много места для маневра, чтобы вы могли добавить больше продуктов, таких как кофе, напитки, фрукты, закуски, десерт, вино и т. д.
# Жареный сыр включает 2 тонко нарезанных цельнозерновых хлеба и 1 ломтик (¾ унции) сыр чеддер.

*Документ Google

Распечатать список покупок

Список покупок

Продукция

  • 1 средний банан
  • 1 средняя груша (любой сорт)
  • 2 средних яблока (любого сорта)
  • 6 средних апельсинов
  • 1 средний лимон
  • 3 средних лайма
  • 1 фунт красного или зеленого винограда без косточек
  • 2 средние головки чеснока
  • 2 больших лука-шалота
  • 1 (3 дюйма) кусочек свежего имбиря
  • 1 средний перец халапеньо
  • 1 маленький красный сладкий перец ПЛЮС 1 средний
  • 1 маленький (5 унций) ПЛЮС 1 средний (6 унций) ПЛЮС 1 большой (7 унций) авокадо Хасс
  • 1 маленький огурец
  • 1 небольшой пучок сельдерея
  • 1 небольшой пучок моркови
  • 1 фунт батата или батата
  • 5 унций нарезанных белых грибов
  • 8 унций нарезанных грибов Cremini или baby Bella
  • 3 ½ унции грибов шиитаке
  • 2 фунта соцветий брокколи
  • 3 больших пучка зеленого лука
  • 1 средний контейнер/пучок свежего тайского базилика (при желании можно заменить итальянским базиликом в «Пьяных креветках»)
  • 1 небольшой контейнер/пучок свежего базилика
  • 1 небольшой контейнер/пучок свежего тимьяна (при желании можно добавить пару щепоток сухого тимьяна в томатный суп с базиликом)
  • 1 небольшой пучок свежей итальянской петрушки
  • 1 небольшой пучок свежей кинзы
  • 1 (1 фунт) пакет/раскладушка смешанная зелень
  • 1 пакетик (5 унций)/раскладушка для молодого шпината
  • 1 маленький кочан салата романо
  • 1 средний кочан салата айсберг
  • 1 средний кочан салата бибб (при желании можно добавить листья айсберга в салат с куриным салатом)
  • 1 пакетик (нашинкованный) или кочан краснокочанной капусты
  • 3 средних спелых помидора
  • 1 маленькая красная луковица
  • 1 маленькая ПЛЮС 3 средние желтые луковицы

Мясо, птица и рыба

  • 1 упаковка колбасы из индейки (при желании можно заменить беконом в маленьком пироге с заварным кремом)
  • 1 упаковка бекона посередине
  • 1 маленькая упаковка чоризо
  • 6 унций нарезанной куриной грудки или индейки
  • стейк из пашины весом 1 фунт
  • 1.3 фунта 99% нежирного фарша из индейки
  • 1 ½ фунта куриной грудки без костей и кожи
  • 4 средних куриных голени
  • 4 средних куриных бедра на кости
  • 1 фунт куриного фарша
  • 1 фунт больших очищенных креветок и креветок

Зерновые*

  • 1 буханка тонко нарезанного цельнозернового хлеба (мне нравится Dave’s Killer Bread)
  • 1 маленькая упаковка небеленой муки общего назначения
  • 1 маленькая упаковка овсяных хлопьев быстрого приготовления
  • 1 маленькая упаковка кукурузных лепешек (нужно 12 штук)
  • 1 упаковка (8 унций) очень широкой рисовой лапши
  • 1 небольшая упаковка сухого коричневого риса (или 3 чашки предварительно приготовленного)
  • 1 упаковка яичной лапши без желтка

Приправы и специи

  • Оливковое масло первого холодного отжима
  • Растительное масло
  • Кулинарный спрей
  • Спрей с оливковым маслом (или приобретите масляный спрей Misto)
  • Кошерная соль (мне нравится Diamond Crystal)
  • Мельница для перца (или свежего перца горошком)
  • Белый перец (при желании можно заменить черным перцем в говядине и брокколи)
  • Майонез
  • Вустерширский соус
  • Чабрец
  • Красный винный уксус
  • Приправа Адобо
  • Чесночный порошок
  • Тмин
  • Соевый соус с обычным или пониженным содержанием натрия*
  • Кунжутное масло
  • Семена кунжута
  • Корица
  • Специя для тыквенного пирога
  • Порошок чили
  • Паприка
  • Лавровый лист
  • Устричный соус
  • Рыбный соус
  • Хойсин
  • Соус Шрирача
  • Рисовый уксус
  • Мед
  • Куркума
  • Молотый имбирь
  • Прованские травы или приправа для птицы
  • Легкая заправка винегрет (или приготовьте самостоятельно из ингредиентов, указанных в списке)

Молочные продукты и прочееОхлажденные продукты

  • 2 дюжины крупных яиц
  • 1 пакет (8 унций) тертого сыра чеддер
  • 1 пакет (8 унций) тертого сыра Колби-Монтерей Джек
  • 1 упаковка (8 унций) нарезанного сыра чеддер
  • 1 маленькая коробка несоленого сливочного масла
  • 1 маленькая банка сметаны с пониженным содержанием жира
  • 1 небольшой ломтик сыра пекорино романо
  • 1 литр 2% молока
  • 1 контейнер (12 унций) немолочного молока (можно заменить 1 стаканом 2% молока в овсяных хлопьях, если необходимо)
  • Взбитые сливки (по желанию, для тыквенного пирога с овсянкой)

Консервы и банки

  • 1 банка (8 унций) для каштанов
  • 1 (14.5 унций) банка нарезанного кубиками картофеля (при желании можно заменить 1 3/4 чашки нарезанного кубиками вареного картофеля)
  • 2 банки (4,5 унции) зеленого чили, нарезанного кубиками
  • 1 средняя банка молочной сальсы с кусочками молока
  • 1 маленькая банка каперсов
  • 1 банка (28 унций) целых помидоров сорта Сан-Марцано
  • 1 банка (10 унций) мягких помидоров RoTel, нарезанных кубиками
  • 1 банка томатного соуса (8 унций)
  • 1 банка (4 унции) или тюбик (4,5 унции) томатной пасты
  • 2 банки (15 унций) нута
  • 1 банка тунца (6 унций) в воде
  • 1 (32 унции) куриный бульон с пониженным содержанием натрия в коробке
  • 1 коробка (32 унции) овощного или говяжьего бульона с пониженным содержанием натрия
  • 1 маленькая баночка тыквенного масла (или ингредиенты для собственного приготовления)

Замороженный

РазноеГалантерея

  • 1 маленькая упаковка несоленых орехов кешью (при покупке оптом вам понадобится 2 столовые ложки)
  • 1 маленькая упаковка семян чиа (при покупке оптом вам понадобится 2 чайные ложки)
  • 1 небольшая упаковка орехов пекан, тыквенных семечек или грецких орехов (при покупке оптом вам понадобится 2 столовые ложки)
  • 1 бутылка белого вина
  • 1 маленькая упаковка темно-коричневого сахара
  • Кукурузный крахмал

Непродовольственные товары

Распечатать список покупок

Добавка аминокислот с разветвленной цепью восстанавливает сниженную инсулинотропную активность низкобелковой диеты через блуждающий нерв у крыс | Питание и метаболизм

Материалы

Казеин, α-кукурузный крахмал, целлюлоза, смесь витаминов и смесь минералов были приобретены у Oriental Yeast Co., Ltd. (Токио, Япония). Клетки MIN6 [28] были предоставлены доктором Дж. Миядзаки, Высшая школа медицины Университета Осаки (MTA13–148).

Животные

Самцов крыс Wistar в возрасте 6 или 7 недель (160–210 г) приобретали у Japan Laboratories Inc. (Токио, Япония) и помещали в комнату с 12-часовым циклом свет/темнота (06:00). –18:00) при температуре 22–24 °С. Крысам был предоставлен свободный доступ к стандартному корму (MF; Oriental Yeast Co., Ltd.) и воде в течение 2 или 3 дней для адаптации к условиям содержания.Перед экспериментами на животных крысам давали контрольную диету, содержащую 20% казеина в качестве источника белка (20P), с 8:00 до 16:00 в течение 4 дней и обучали ограниченному по времени кормлению, которое применялось ко всем экспериментам на животных. Состав рациона 20P показан в Таблице 1.

Таблица 1 Состав рациона, дополненного аминокислотами

Эксперименты на животных

Эксперимент 1: Влияние низкобелковой диеты на концентрацию аминокислот в плазме

После ночного голодания в течение 16 часов крыс кормили 20P или низкобелковой диетой, содержащей 5% казеина (5P) в течение 30 мин. .Образцы крови из артерии и воротной вены набирали в шприц, содержащий гепарин, под ингаляционной анестезией изофлураном для измерения концентрации свободных аминокислот в плазме. Состав диеты 5P показан в Таблице 1.

Эксперимент 2: Влияние исключения одной аминокислоты на секрецию инсулина

После ночного голодания в течение 16 часов крысам давали контрольную диету, содержащую 20% аминокислотную смесь, имитирующую казеин. (20AA), или диеты, лишенные одной аминокислоты.Состав 20AA показан в таблице 2. Рационы, лишенные отдельных аминокислот, были приготовлены путем удаления каждой аминокислоты из 20AA и добавления такого же количества глутаминовой кислоты (Glu), которая является наиболее распространенной заменимой аминокислотой в 20AA. чтобы содержание аминокислот во всех опытных рационах было одинаковым. Образцы крови получали путем разреза хвоста и забора в пробирки с гепарином через 0, 1 и 2 часа после кормления для измерения уровней инсулина и глюкозы в плазме. Плазму отделяли центрифугированием при 700×g в течение 5 минут при 4°C и замораживали при -80°C до использования.

Таблица 2 Состав диеты с ограничением аминокислот
Эксперимент 3: Влияние ограничения аминокислот с разветвленной цепью на секрецию инсулина количество аминокислот с разветвленной цепью (BCAA) (валин (Val), Leu, изолейцин (Ile) или три BCAA). В отличие от рационов, лишенных аминокислот, использованных в Эксперименте 2, рационы с ограничением BCAA были приготовлены путем снижения содержания BCAA до 25% от 20AA и добавления того же количества Glu, что делает общее содержание аминокислот в BCAA -ограниченные диеты такие же, как 20AA.Состав рациона показан в Таблице 2. Образцы крови собирали через 0, 1 и 2 ч после кормления и готовили для измерения концентраций инсулина и глюкозы в плазме, как описано в Эксперименте 1. На следующий день после взятия образцов крови, описанных выше образцы крови из артерии набирали в шприц, содержащий гепарин, под ингаляционной анестезией изофлураном для измерения концентраций свободных аминокислот в плазме через 30 минут после начала кормления.

Эксперимент 4: Влияние добавок аминокислот с разветвленной цепью к низкобелковой диете на секрецию инсулина , иль или три BCAA.Диеты с добавками BCAA были приготовлены путем добавления BCAA до уровня 20P, а Glu был добавлен, чтобы сделать содержание аминокислот в диетах с добавками 5P и BCAA одинаковым. Состав рациона показан в таблице 1. Образцы крови собирали и готовили для измерения концентрации инсулина, глюкозы и свободных аминокислот в плазме, как описано в экспериментах 2 и 3.

Эксперимент 5: Влияние ваготомии на инсулинотропный эффект аминокислот с разветвленной цепью

Ваготомию самцов крыс Wistar в возрасте 6 недель проводили под анестезией пентобарбиталом натрия (64.8 мг/кг внутрибрюшинно, сомнопентил; Kyoritsu Pharmaceutical Co. Ltd., Токио, Япония). Обнажены и удалены дорсальная и вентральная ветви блуждающего нерва, которые проходят вдоль пищевода ( n  = 39). Имитация ваготомии была проведена той же хирургической процедурой, за исключением удаления блуждающего нерва ( n  = 14). После ваготомии крыс кормили 20Р с 8:00 до 16:00 ежедневно до начала эксперимента. Через пять дней после ваготомии был проведен тест на насыщение на холецистокинин (ХЦК) для подтверждения успеха хирургического вмешательства; после 16 часов натощак CCK (CCK-октапептид; Peptide Institute, Inc., Осака, Япония) вводили внутрибрюшинно (1,6 мкг/100 г массы тела) и измеряли потребление пищи в течение последующих 10 минут [29]. Крысы без эффекта сытости CCK были отобраны как подвергнутые ваготомии и использованы в эксперименте ( n  = 26). Через два дня после теста CCK крыс лишали пищи на 16 часов и кормили 20P, 5P, 5P с добавлением трех BCAA или 5P с добавлением Leu в течение 1 часа. Образцы крови собирали через 0, 0,5 и 1 ч после кормления и готовили для измерения концентраций инсулина и глюкозы в плазме, как описано в экспериментах 2 и 3.

Эксперимент 6: влияние сниженного потребления пищи на секрецию инсулина

После ночного голодания в течение 16 часов крыс разделили на две группы и давали 2,5 г 20P или кормили 20P ad libitum в течение 1 часа. Образцы крови получали путем разреза хвоста через 0, 0,5 и 1 ч после кормления и готовили для измерения концентраций инсулина и глюкозы в плазме, как описано в экспериментах 2 и 3.

Анализ плазмы

добавляя равное количество 3% трихлоруксусной кислоты, концентрации свободных аминокислот измеряли с помощью анализатора аминокислот ВЭЖХ (Hitachi High-Technologies Corporation, Токио, Япония).Концентрации глюкозы и инсулина в плазме измеряли с использованием набора для тестирования глюкозы CII (Wako Pure Chemical Industries, Ltd., Осака, Япония) и набора для твердофазного иммуноферментного анализа (ELISA) крысиного инсулина (Shibayagi Co., Ltd., Гунма, Япония). , соответственно.

Эксперименты с клетками

Клетки MIN6 поддерживали в модифицированной Дульбекко среде Игла (DMEM) с высоким содержанием глюкозы (25 мМ) с добавлением 20% термоинактивированной фетальной телячьей сыворотки, 5 мкл/л 2-меркаптоэтанола, 100 единиц/мл пенициллина и 100 мкг/мл стрептомицина и инкубировали во влажном 5% CO 2 при 37 °C.Субконфлюэнтные клетки (пассажи 24 и 25) предварительно инкубировали в буфере Гепеса-Кребса, содержащем 3 мМ глюкозы без аминокислот или с аминокислотами, в течение 1 ч и после двукратной промывки буфером Гепеса-Кребса клетки инкубировали в той же среде, содержащей 3 мМ или 25 мМ глюкозы еще на 1 ч. Инсулин в среде измеряли с использованием набора для ELISA для инсулина мыши (Shibayagi Co., Ltd.), а концентрации нормализовали к содержанию белка в клеточном лизате, определенному с использованием набора для анализа белка Bio-Rad (Bio-Rad, Hercules, Калифорния, США).

Статистика

Результаты выражены как среднее ± S.E.M. Все наборы данных были проверены на нормальность, и для нормально распределенных данных был проведен тест F . Критерий Манна-Уитни U использовали для искаженных данных. Гомоскедастические и гетероскедастические данные оценивали с помощью непарного t -критерия Стьюдента и непарного t -критерия Уэлча соответственно. Двусторонний дисперсионный анализ (ANOVA) был выполнен для результатов эксперимента 5. Уровень значимости был установлен на уровне P  < 0.05. Все статистические анализы проводились с использованием Excel Statistics 2008 (Social Survey Research Information Co., Ltd., Токио, Япония).

«Деколонизируйте свой рацион» с помощью местных продуктов — Северный ветер

Узнавали ли предки пищу, которую люди едят сегодня? Узнают ли люди сегодня пищу прошлых веков?

Ответ на эти вопросы витал в ароматных ароматах, исходящих от домашнего печенья с маслом для загара и чая из белых сосновых игл, приготовленных из ингредиентов, родом из региона Великих озер.Традиционная еда коренных американцев была приготовлена ​​Мартином Рейнхардтом, доктором философии, адъюнкт-профессором исследований коренных американцев NMU и главным исследователем проекта «Деколонизация диеты» (DDP).

«Силы колонизации навсегда изменили нашу среду обитания», — сказал Рейнхардт. «Радиационное загрязнение Фукусимы все еще находится в почве. Наша диета никогда не может быть по-настоящему деколонизирована, потому что мы едим в колонизированном месте».

Студенты, преподаватели и сотрудники — 22 участника мероприятия «Деколонизируй свою диету» с 17:00 до 18:30.м в комнате 1320 Jamrich Hall 3 апреля. Мероприятие было организовано студенткой EcoReps Миной Стампфолл, младшим специалистом по экологии, и Брайсом ДеМерсом, младшим специалистом по экологии.

Однажды, готовя еду для Дегустатора еды первых наций, Райнхардта осенило осознание: еда, которая предположительно представляла его культуру охотников и собирателей, на самом деле содержала минимальные следы того, что его предки изначально ели в районе Великих озер. Вместо этого еда была из далеких мест, к которым его предки не могли получить доступ, и поэтому она не включалась в их доколониальный рацион.

Вопрос о том, узнают ли его предки сегодня его еду или нет, переплелся с вопросом, сможет ли он распознать их еду, сказал Рейнхардт. Он объяснил, что вопрос перерос в исследовательскую деятельность, и так появился проект «Деколонизация диеты».

Он начал планировать DDP в 2010 году. Первое, что нужно было сделать Райнхардту, — определить рассматриваемую область. Он дал всем в офисе по изучению коренных американцев карту и попросил провести линию, где находится район Великих озер.

«Конечно, все результаты были разными. Мы хотели быть инклюзивными, но также должны были подвести черту», ​​— сказал Рейнхардт.

Он позвонил жителям штатов, расположенных в бассейнах Великих озер, и спросил, считают ли они себя живущими в районе Великих озер. По словам Рейнхардта, все пришли к единому мнению, что там, где когда-то проживали племена и где существовали водоразделы, регион будет определен как Великие озера.

Через два года проект был реализован с участием 25 человек.В течение года Рейнхардт и несколько других участников придерживались строгой диеты, состоящей только из ингредиентов, произрастающих в районе Великих озер. Остальные люди в исследовании дополняли свой рацион, потребляя 25 или менее процентов местной пищи.

«Сначала люди очень обрадовались и начали проводить собственные исследования, — говорит Грейс Чайлер, внештатный доцент кафедры изучения коренных американцев.
Колонизированная диета лишила коренных жителей питательных веществ, которые преобладали в еде коренных народов, и увеличила количество холестерина в их рационе, что привело к проблемам со здоровьем, объяснил Рейнхардт.

«Болезни сердца и проблемы, связанные с ожирением, убивают больше индийцев, чем Джон Уэйн», — сказал Рейнхардт.

DDP измерял обхват талии участников, уровень холестерина, уровень глюкозы в крови, ожирение, артериальное давление и ИМТ. После года употребления в пищу продуктов местного производства у половины участников улучшилось состояние здоровья, а у другой половины оно не изменилось. По его словам, по большей части Рейнхардт обнаружил значительное снижение уровня холестерина, веса и обхвата у участников и у себя.

Варианты местных продуктов питания чрезвычайно ограничены по сравнению с сегодняшним глобальным колонизированным рынком, сказал он.

«Вы не можете пойти в супермаркет и пройтись по отделу с местной едой», — согласился Шайлер. «Вы не можете пойти в центр города и увидеть местный фургон с едой».

Из-за этого, по словам Райнхардта, он платил большие деньги и посвящал много времени поиску пищи, приготовлению и хранению местных продуктов.

Участников DDP не смутила ограниченная доступность местных вариантов.Они стали находчивыми. Они измельчали ​​кузнечиков для приправы, использовали кору белой сосны и семена тыквы в качестве муки и использовали подсолнечное масло в качестве жировой основы.

Тех, кто заинтересован в том, чтобы перейти на деколониальную диету, Райнхардт призвал людей сделать это по значимой причине и научиться уважительно добывать корм, находясь на участках и без того хрупкой земли коренных народов.

«Каждый день я тратил на подготовку еще четыре часа, но оно того стоило, — сказал Рейнхардт.
Дополнительную информацию о DDP можно найти на decolonizingdietproject.blogspot.com.

.